|

 

Diabetes.diabetesjournals.org

Tetracycline Treatment Retards the Onset and Slows the
Progression of Diabetes in Human Amylin/Islet Amyloid
Polypeptide Transgenic Mice
Jacqueline F. Aitken,1,2 Kerry M. Loomes,1,2 David W. Scott,1,3 Shivanand Reddy,1
Anthony R.J. Phillips,1,2,4 Gordana Prijic,1 Chathurini Fernando,1 Shaoping Zhang,1,2
Ric Broadhurst,5 Phil L'Huillier,5 and Garth J.S. Cooper1,2,3,6
polypeptide (hA/hIAPP) into small soluble ␤-sheet– containingoligomers is linked to islet ␤-cell degeneration and the pathogen-esis of type 2 diabetes. Here, we used tetracycline, whichmodifies der caused by defective action and/or secretionof insulin, which manifests with complications whereby hA/hIAPP causes diabetes in hemizygous hA/hIAPP- that ultimately cause most of its morbidity and transgenic mice.
mortality. It is also an amyloidosis, since it is accompanied by amyloid deposits in regions of tissue degeneration and treated hemizygous hA/hIAPP transgenic mice with oral tetracy- ␤-cell loss in the islets of Langerhans (1,2). These deposits cline to determine its effects on rates of diabetes initiation, (3) comprise mainly fibrillar aggregates of a 37–amino acid progression, and survival.
monomer, human amylin (hA)/islet amyloid polypeptide RESULTS—Homozygous mice developed severe spontaneous
(hIAPP) (4,5) (the term hA/hIAPP has been used to reflect diabetes due to islet ␤-cell loss. Hemizygous transgenic animals the two names commonly used for this peptide hormone), also developed spontaneous diabetes, although severity was less which is secreted from the ␤-cells.
and progression rates slower. Pathogenesis was characterized by Islet amyloid is associated with substantial reductions in initial islet ␤-cell dysfunction followed by progressive ␤-cell loss.
relative ␤-cell mass in type 2 diabetes (on average ⬃60%), Islet amyloid was absent from hemizygous animals with early- probably due to increased apoptosis compared with obese onset diabetes and correlated positively with longevity. Somelong-lived nondiabetic hemizygous animals also had large islet- and lean nondiabetic humans (2). An inability to adap- amyloid areas, showing that amyloid itself was not intrinsically tively compensate ␤-cell mass in type 2 diabetes has been cytotoxic. Administration of tetracycline dose-dependently ame- postulated to lead to or cause an absolute insulin defi- liorated hyperglycemia and polydipsia, delayed rates of diabetes ciency over time with a resulting requirement for insulin initiation and progression, and increased longevity compared replacement therapy in affected subjects (1).
with water-treated controls.
Several lines of evidence now provide compelling sup- CONCLUSIONS—This is the first report to show that treating
port for the idea that processes associated with hA/hIAPP hA/hIAPP transgenic mice with a modifier of hA/hIAPP misfold- aggregation contribute to ␤-cell degeneration. First, in ing can ameliorate their diabetic phenotype. Fibrillar amyloid vitro studies with synthetic hA/hIAPP preparations show was neither necessary nor sufficient to cause diabetes and indeed that fibrillar structures are generated spontaneously was positively correlated with longevity therein, whereas early- through self-association of monomers into protofibrils and to mid-stage diabetes was associated with islet ␤-cell dysfunction higher-order fibrils (6). Cytotoxic hA/hIAPP preparations followed by ␤-cell loss. Interventions capable of suppressingmisfolding in soluble hA/hIAPP oligomers rather than mature contain few preformed fibrils but undergo time-dependent fibrils may have potential for treating or preventing type 2 aggregation into soluble ␤-conformers (7). ␤-Cell toxicity diabetes. Diabetes 59:161–171, 2010
evoked by aggregating extracellular hA/hIAPP occursthrough an apoptotic mechanism (8,9) mediated via apathway comprising initial activation of a membrane- From the 1School of Biological Sciences, Faculty of Medical and Health bound Fas/FasL/FADD/caspase-8 complex (10) followed Sciences, University of Auckland, Auckland, New Zealand; the 2Maurice by a three-pronged downstream cascade comprising Wilkins Centre for Molecular Biodiscovery, Faculty of Science, University c-Jun NH -terminal protein kinase 1/cJun (11), activat- of Auckland, Auckland, New Zealand; the 3Department of Medicine, Facultyof Medical and Health Sciences, University of Auckland, Auckland, New ing transcription factor 2/p38 mitogen-activated protein Zealand; the 4Department of Surgery, Faculty of Medical and Health kinase (12), and p53/p21WAF1/CIP1 (9) that leads ulti- Sciences, University of Auckland, Auckland, New Zealand; 5AgResearch, mately to activation of caspase-3 (13). In addition, Ruakura, Hamilton, New Zealand; and the 6Department of Pharmacology,Medical Sciences Division, University of Oxford, Oxford, U.K.
parallel amylin-mediated activation of endoplasmic re- Corresponding author: Garth J.S. Cooper, [email protected].
ticulum stress–related pathways may contribute to islet Received 15 April 2009 and accepted 4 September 2009. Published ahead of ␤-cell degeneration (14).
print at http://diabetes.diabetesjournals.org on 30 September 2009. DOI:10.2337/db09-0548.
Second, associations between hA/hIAPP aggregation J.F.A., K.M.L., and D.W.S. contributed equally to this article.
and decreased ␤-cell mass have been reported from in vivo 2010 by the American Diabetes Association. Readers may use this article as studies (15–19) in several murine transgenic models of long as the work is properly cited, the use is educational and not for profit, hA/hIAPP-mediated diabetes. By contrast, mA/mIAPP mol- and the work is not altered. See http://creativecommons.org/licenses/by-nc-nd/3.0/ for details.
ecules do not aggregate, so diabetic phenotypes in hA/ The costs of publication of this article were defrayed in part by the payment of page hIAPP transgenic mice develop in a background devoid of charges. This article must therefore be hereby marked "advertisement" in accordancewith 18 U.S.C. Section 1734 solely to indicate this fact. amyloid formed by mA/mIAPP. Obese hA/hIAPP trans- DIABETES, VOL. 59, JANUARY 2010 TETRACYCLINE CURBS DIABETES IN hA/hIAPP MICE
genic mice have been reported to replicate pathological (16 –18 h) with free access to water. Glucose was administered (1 mg findings of human type 2 diabetes, showing nonketotic glucose/g body wt) followed by tail blood sampling.
Blood and tissue extraction for hormone measurements. Cardiac punc-
hyperglycemia, amyloid deposition, and decreased ␤-cell ture blood (EDTA) was separated (3,000g, 4°C, 15 min). Pancreata were mass, possibly via increased apoptosis (18).
excised and snap frozen (liquid nitrogen) and peptides extracted (homogeni- These data support a hypothesis that hA/hIAPP aggre- zation, acid/ethanol) (27).
gation could mediate ␤-cell failure in type 2 diabetes.
Hormone measurements. Murine insulin was determined in plasma, serum,
However, the significance of mature amyloid fibrils in the or pancreatic extracts by Ultrasensitive Mouse Insulin enzyme-linked immu-nosorbent assay (ELISA) (Mercodia, Uppsala, Sweden) or rat/mouse insulin pathogenesis of this process is still uncertain, as is ELISA (Linco). Pancreatic extracts were diluted (1:500 and 1:5,000) in PBS whether hA/hIAPP-mediated cytotoxicity can be abro- (pH 7.4). Plasma hA/hIAPP was determined by ELISA (Linco) in plasma and gated by in vivo treatment with amylin-binding com- pounds. Peptide-based analogs that bind amyloid-forming structural motifs within hA/hIAPP have reportedly inhib- Pancreatic histochemistry and quantitative islet histomorphometry.
Pancreatic tissue was paraffin embedded, serially sectioned (5 ␮m), and
ited aggregation of synthetic hormone in vitro, with con- stained with hematoxylin and eosin. On adjacent sections, Congo red (1%; comitant suppression of cytotoxicity in cultured ␤-cells 15–20 min, then saturated lithium carbonate, 30 s) and hematoxylin staining (20), but in vivo efficacy of this therapeutic approach has were used to measure frequency and extent of islet amyloid (polarization yet to be reported.
microscopy). Islet morphology and amyloid content were analyzed by a Here, we have generated lines of hA/hIAPP transgenic single-blinded histologist who scored nine or more islets/animal. Pancreata mice that spontaneously develop diabetes. Phenotypes were sectioned at sufficient levels (ⱖ200 ␮m apart) to ensure analysis of ⱖ9(but generally ⬃20 –30) distinct islets/animal.
vary from early-onset diabetes without microscopically Immunohistochemistry. Representative sections were serially incubated
detectable amylin aggregates to late-onset diabetes with with guinea pig anti-insulin serum, donkey anti-guinea pig IgG–fluorescein microscopic amyloid deposits. Diabetes pathogenesis and isothiocyanate, rabbit anti-glucagon, and donkey anti-rabbit IgG–Texas Red progression in hemizygous animals occurs primarily then counterstained with Congo red and reimaged to quantitate islet amyloid, through islet ␤-cell dysfunction with subsequent ␤-cell morphology, and insulin and glucagon cells. Alternatively, sections wereincubated with combined rabbit anti-glucagon and anti-somatostatin and loss. Both onset and progression were significantly inhib- imaged by indirect avidin-biotin-peroxidase.
ited by chronic treatment with tetracycline, an antibiotic Chronic oral administration of tetracycline. Tetracycline was adminis-
that interacts with aggregates of proteins implicated in tered orally via the drinking water in light-proof bottles either from the time amyloid-related diseases (21–23).
of weaning (21 days of age) or from diabetes onset in different studies, at finalconcentrations (0.03 mg/ml or 0.5 mg/ml in water, 18 mol 䡠 l⍀⫺1 䡠 cm⫺1, milliQ;Millipore) and fresh solutions constituted weekly. Polydipsia was defined asfluid intake exceeding twice the average daily intake of the average nondia- RESEARCH DESIGN AND METHODS
betic adult mouse. Controls comprising hemizygous male mice and nontrans- Ethics approval. Experimental protocols were approved by the University of
genic littermates received milliQ water alone.
Auckland Animal Ethics Committee and performed in accordance with the Statistical analysis. Data were analyzed using GraphPad Prism 4 (GraphPad
New Zealand Animal Welfare Act (1999).
Software, San Diego, CA) and diabetes onset and survival using the Mantel- Materials. Chemicals and kits were from Roche Applied Biosciences, Invitro-
Haenszel log-rank test and the Gehan-Breslow-Wilcoxon test. Correlation gen, Life Technologies/BRL, or Sigma and were of analytical grade or better, analyses were performed using Pearson correlation with two-tailed hypothe- unless stated otherwise.
ses. Descriptive variables were contrasted by one-way ANOVA with Tukey- Generation of hA/hIAPP transgenic mice. The hA/hIAPP transgene (sup-
Kramer post hoc tests. Blood glucose and fluid intake values were contrasted plemental Fig. S1A [available at http://diabetes.diabetesjournals.org/cgi/ using mixed models fitted by restricted maximum likelihood (JMP 5.1; SAS content/full/db09-0548/DC1]) was constructed from PCR-derived fragments Institute). P values of ⬍0.05 were considered significant.
using the following primer pairs: RIP5 (GAAAGACTCGAGGATCCCCCAACCAC) and RIP3 (CAGGGCCATGGTGGAACAATGACC), hAMY5 (GAAGC Human amylin/hIAPP transgenic mice spontaneously
GAAA) and hALB3 (CAACCTCAAGCTTGTCTGGGCAAGGG), hGAPDH5 developed diabetes. Transgenic animals were generated
within a FVB/N background (supplmentary Fig. S1). One GTCT-AGACTTCCTCCACCTGTCA). It was introduced into the genome by transgenic line, hereinafter designated as Line 13, had pronuclear injection (24).
integrated transgene copy numbers of 36 ⫾ 7 and 76 ⫾ 2 Northern analysis. RNA was extracted from liquid nitrogen snap-frozen
tissues using QIAGEN RNeasy Midi Kits according with the rotor-stator tissue
for hemizygous and homozygous animals, respectively disruption (Ultra-Turrax T8; IKA-Werke, Germany). Total RNA (20 ␮g) was (data not shown).
denatured and transferred to nylon membranes with 20⫻ SSC (25) and Diabetes developed spontaneously and reproducibly in hybridized to 32P-labeled probes (26) at 65°C overnight. Intensities of mRNA both homozygous and hemizygous Line 13 male and bands corresponding to hA/hIAPP and mA/mIAPP were not directly compared female mice, while nontransgenic littermates did not de- as experimental conditions differed (supplemental Fig. S1A and B).
velop hyperglycemia (Fig. 1). All subsequent studies were Animal studies. Mice were fed ad libitum with Diet 86 (Tegel NRM,
Auckland, Zealand), a dry-pelleted natural-ingredient diet with 3% fat. Blood
performed in male animals (28,29). In homozygous mice, glucose levels were determined in tail vein blood (Advantage II; Roche) and diabetes developed in 100% of animals (n ⫽ 6) by 41 days diabetes defined when concentrations were ⬎11 mmol/l on two consecutive and all were dead by 91 days (Fig. 1A). By comparison, weekly readings. For survival studies, we applied an agreed euthanasia median values for time to diabetes onset and lifespan surrogate end point for death, consistent with current ethical practice.
within the hemizygous group were longer (175 and 272 Euthanasia was performed in the following circumstances: after 20% loss of days, respectively) compared with homozygous animals maximum body weight, if significant lethargy developed, following loss ofexploratory behavior with increasing relative immobility, failure to groom, (35 and 63 days, respectively). In addition, a second, or any other signs of overt distress. Infection or malignancy were also independent line (designated Line 20) generated with the accepted as indications for euthanasia.
same construct and methods also developed spontaneous Intraperitoneal insulin and glucose tolerance tests. Mice undergoing
diabetes (Fig. 1A). Thus, the diabetic phenotype was not intraperitoneal insulin tolerance tests (ITTs) were typically fasted for 6 h.
an artifact arising from insertional mutagenesis.
Thereafter, actrapid (0.5 mIU/g body wt; Novo Nordisk) was injected intra- Intraperitoneal ITTs performed at 85 days showed that peritoneally in conscious animals (29 G needle). Glucose levels were mea-sured hemizygous mice developed spontaneous diabetes within intraperitoneal glucose tolerance tests (GTTs), mice were overnight fasted a background of normal insulin sensitivity (Fig. 1B). Time DIABETES, VOL. 59, JANUARY 2010 J.F. AITKEN AND ASSOCIATES
100 200 300 400 500 600 Diabetes to death (days) Percent amyloid/islet area Diabetes onset (days) FIG. 1. Characterization of spontaneous diabetes in homozygous and hemizygous hA/hIAPP transgenic mice. A: Survival curves for two distinct
lines of hA/hIAPP transgenic mice that were generated by separate injections of the same construct in the FVB/N background: homozygous line
13 (‚, n ⴝ 6); hemizygous line 13 (E, n ⴝ 14); and hemizygous line 20 (ƒ, n ⴝ 7). Closed symbols represent corresponding nontransgenic
littermates. B: Intraperitoneal insulin tolerance tests in hemizygous line 13 mice (E, n ⴝ 11) versus nontransgenic littermates (F, n ⴝ 6) at 85
days of age. Animals were fasted overnight (17 h) then injected with Actrapid (0.75 mIU/g body wt). Data are means ⴞ SE. C: Correlational
analysis between time to diabetes onset and time of diabetes onset to death in hemizygous line 13 mice (P ⴝ NS, n ⴝ 19). D: Amyloid areas were
positively correlated with lifespan in diabetic water-treated (E, dashed line; n ⴝ 14, R2 ⴝ 0.78, P < 0.001) and nondiabetic hemizygous animals
(half-closed circles, n ⴝ 4, R2 ⴝ 0.95, P < 0.05). Arrows indicate animals with representative islets shown in Fig. 2.
to diabetes onset was not correlated with the period These data indicated that an ⬃2- to 2.5-fold increase in between diabetes onset and death, showing that age did expression of hA/hIAPP above endogenous and nonamy- not influence the rate of progression of diabetes once it loidogenic mA/mIAPP in hemizygous animals was suffi- had begun (Fig. 1C).
cient to evoke diabetes.
Severity of diabetes progression was directly related
Amyloid deposition was dissociated from diabetes
to pancreatic expression of amyloidogenic human
and positively correlated with lifespan. To investigate
amylin. In homozygous mice, at an age where they were
the relationship between amyloid deposition and diabetic glucose intolerant (30 days; intraperitoneal GTTs not phenotype, islet amyloid area was quantitated microscopi- shown), plasma hA/hIAPP concentrations were 1.8-fold cally. Of the diabetic hemizygous animal cohort examined, higher than in hemizygous animals and ⬃3.7-fold above there was a positive correlation between amyloid content nontransgenic control mA/mIAPP concentrations (Table and lifespan in animals that had survived ⬎220 days (44% 1). Normal plasma insulin was maintained in homozygous frequency, P ⬍ 0.001) (Fig. 1D and Fig. 2, top two panels).
mice at 30 days despite a 72% reduction in pancreatic However, amyloid was rarely observed in terminally diabetic insulin content. Thus, at a time point similar to the median animals killed at lifespans ⬍220 days (49% frequency). As time to diabetes (35 days), substantial pancreatic insulin expected, amyloid deposition was never observed in the depletion had occurred in homozygous transgenic mice islets of nontransgenic animals (Fig. 2, middle panel). Inter- before a reduction in circulating insulin concentrations estingly, some hemizygous animals remained nondiabetic was detectable. Interestingly, and by contrast, pancreatic (7% frequency) but showed the presence of islet amyloid insulin concentrations in hemizygous animals were rela- (Fig. 1D and Fig. 2, second to bottom panel) with a similar tively unchanged at a time point (183 days) similar to the relationship between amyloid content and lifespan as ob- respective median onset time to diabetes (175 days).
served for diabetic hemizygous animals (P ⬍ 0.05). Amyloid DIABETES, VOL. 59, JANUARY 2010 TETRACYCLINE CURBS DIABETES IN hA/hIAPP MICE
TABLE 1Hormone concentrations in plasma and pancreatic tissue from fed wild-type (⫺/⫺) and hemizygous (⫹/⫺) and homozygous (⫹/⫹)hA/hIAPP transgenic mice at 30 days and 4 months of age Pancreas (pmol/mg) 221 ⫾ 55‡ (5) 1,261 ⫾ 142 (8) 1,028 ⫾ 121(16) Data are means ⫾ SE. The ELISA assay used to measure hA/hIAPP has a reported ⱕ1% cross-reactivity with human insulin, glucagon,glucagon-like peptide-1, pancreatic polypeptide, calcitonin, calcitonin gene–related peptide, and adrenomedullin and does not detectablycross-react with mA/mIAPP (39). The in-house radioimmunoassay used to measure mA/mIAPP had 7% cross-reactivity with hA/hIAPP andthus was used only in nontransgenic littermates. *Two pooled analyses representing a total of five animals. †P ⬍ 0.05, two-tailed t test. ‡P ⬍0.001 vs. both groups, one-way ANOVA with Tukey's post hoc test. §P ⬍ 0.01, two-tailed t test. —, not determined; ND, not detected.
was also absent from all terminally diabetic homozygous not significant by the Mantel-Haenszel log-rank test. As Line 13 mice analyzed (Fig. 2, bottom panel).
proportional hazards might not apply in this case, however, End-stage diabetes was characterized by selective
the data were reanalyzed using the Gehan-Breslow-Wilcoxon loss of ␤-cells from the islets. Immunohistochemistry of
test, which does not rely on this assumption. The latter pancreatic islet sections using antisera to stain both ␣- and analysis did reveal a significant difference in median time to ␦-cells showed that almost all the islet cells in terminally diabetes onset (P ⬍ 0.05). Following diabetes onset, progres-diabetic homozygous and hemizygous mice were non–␤- sive hyperglycemia resulted in the development of polydipsia cells (Fig. 2). Glucagon staining also revealed a change in at blood glucose concentrations of ⬃25 mmol/l (Fig. 3A and ␣-cell distribution from the physiological location at the B). Since the upper limit of blood glucose measurement hereislet periphery to a more dispersed distribution throughout was 33 mmol/l, the maximum reported values are lower-limit diabetic islets, a substantive change in histomorphology estimates of actual glucose concentrations in advanced (Fig. 2). Taken together, these findings show that end- stage diabetes in both homozygous and hemizygous ani- Most importantly, in tetracycline-treated hemizygous mals was associated with islet ␤-cell loss and altered islet animals, there was a significant delay in disease progres- architecture. Consistent with these observations, plasma sion following onset of hyperglycemia, as measured by insulin and amylin concentrations in terminally killed retardation in the rates of both blood glucose elevation homozygous and hemizygous animals were below the (Fig. 3A, P ⬍ 0.01) and fluid intake (Fig. 3B, P ⬍ 0.01) limits of detection (data not shown). We also performed compared with water-treated transgenic animals. Tetracy- studies for terminal deoxynucleotidyl transferase-medi- cline had no effects on either blood glucose concentrations ated dUTP nick-end labeling and caspase-3 activation in or fluid intake in nontransgenic littermates over the same islets from animals at different stages of diabetes, but rates time period. We did not quantitate blood tetracycline were not significantly different between those from dia- levels; however, assuming a similar bioavailability to oral betic and control (nondiabetic) animals (results not doxycycline or minocycline administered to mice (32), we shown). These findings are consistent with the observa- estimate that plasma tetracycline concentrations during tion that although apoptosis is widespread in biology, the polydipsic phase could reach low micromolar levels.
dying cells are seldom seen in situ because of their rapid Survival analysis (Fig. 3C) showed that tetracycline- clearance by phagocytosis (30). They do not, however, treated transgenic animals had a significantly increased exclude the possibility that the sensitivity of the assays median survival (34%, P ⬍ 0.05) for the period from used may not have been sufficient to detect any differences diabetes onset to death (155 days, n ⫽ 17) compared with in numbers of rare apoptotic cells.
the water-treated control group (116 days, n ⫽ 19).
Chronic oral administration of tetracycline (0.03
Examination of pancreata from terminally killed tetra- mg/ml drinking water) from weaning improved glyce-
cycline-treated animals also showed a positive correlation mic control and lifespan in hemizygous mice (study
between islet amyloid content and lifespan (Fig. 3D, P ⬍ 1). We previously reported that tetracycline interacts with
0.001, n ⫽ 12, R2 ⫽ 0.91). This finding was similar to that amylin fibrils based on evidence from thioflavin-T fluores- observed for water-treated terminally diabetic hemizygous cence and radioprecipitation assays (31). Here, we provide mice wherein the corresponding regression slope was not additional in vitro evidence for specific interactions between significantly different (Fig. 1D). Interestingly, of all the tetracycline and hA/hIAPP by circular dichroism spectros- pancreata examined in this study the highest amyloid copy (supplementary Fig. S2). In addition, to investigate content occurred in a tetracycline-treated mouse, a finding whether tetracycline might modulate indexes of aggregation- consistent with the correspondingly increased lifespan evoked diabetes in vivo, hemizygous mice were randomly observed in this group.
assigned to groups that were administered either water alone Tetracycline (0.5 mg/ml drinking water) improved
(control) or water containing 0.03 mg/ml tetracycline. Trans- glucose tolerance and delayed diabetes onset in
genic animals treated with tetracycline (0.03 mg/ml) devel- hemizygous animals (study 2). To investigate whether
oped diabetes with an apparently earlier median time to the observed antidiabetes effects of tetracycline might be onset (85 days, n ⫽ 17) compared with those administered attributable to potential indirect insulin-sensitizing effects, water only (121 days, n ⫽ 20), which is a difference that was parallel GTTs and ITTs were performed in independent DIABETES, VOL. 59, JANUARY 2010

J.F. AITKEN AND ASSOCIATES
FIG. 2. Amyloid visualized by light microscopy was dissociable from occurrence of diabetes in hemizygous hA/hIAPP transgenic mice.
Photomicrographs show serial pancreatic islet sections from nontransgenic and human amylin transgenic animals. Left photomicrographs from
top three panels show insulin (green) and glucagon (red) immunoreactivity. Bottom two left photomicrographs show islet sections incubated
with antisera to somatostatin and glucagon revealing brown cytoplasmic staining. Middle and right panels show corresponding light- and
polarized-microscopic field views of adjacent islet sections stained with Congo red. Amyloid birefringence is apple green, whereas that
corresponding to collagen is silvery. The scale bar (50 ␮m) shown in top left photomicrograph applies to all images except for those
corresponding to the 600-day nondiabetic hemizygous mouse (second to bottom row), which represents 100 ␮m. (A high-quality color digital
representation of this figure is available in the online issue.)
cohorts of animals with or without equivalent tetracycline and 60 days treatment (Fig. 4C). Survival analysis indicated a treatment (Fig. 4). Hemizygous mice were administered trend toward delayed diabetes onset in the tetracycline- tetracycline in their drinking water from 30 days post- treated group (P ⫽ 0.06, data not shown).
weaning at 0.5 mg/ml to approximate the increased drug In a parallel study, a second independent hemizygous intake observed during polydipsia in the previous study.
cohort was treated with or without tetracycline immediately GTTs performed on a hemizygous cohort revealed no base- postweaning. ITTs performed after 60 and 90 days treatment line differences (0 days treatment; Fig. 4A) but significantly showed that improved glucose tolerance was not due to any improved glucose tolerance in the tetracycline-treated mice insulin-sensitizing effect of tetracycline (Fig. 4D and E).
compared with water-treated controls at 30 days (Fig. 4B) Tetracycline treatment also significantly delayed the median DIABETES, VOL. 59, JANUARY 2010 TETRACYCLINE CURBS DIABETES IN hA/hIAPP MICE
Blood glucose (mM) Fluid intakee (m/day) Weeks from diabetes onset Weeks from diabetes onset Percent amyloid/islet area 0 200 400 600 800 Weeks from diabetes onset FIG. 3. Chronic administration of tetracycline (0.03 mg/ml of drinking water) in hemizygous mice from the time of weaning ameliorated diabetes
and prolonged survival. Weekly blood glucose values (A) and fluid intake (B) in tetracycline-treated (䡺) versus water-treated (control) (E)
animals. Each point represents the mean ⴞ SE of values derived from n ⴝ 7–20 animals; (F, f): values for corresponding nontransgenic
littermates. Mean drug intake (mg 䡠 kgⴚ1 䡠 dayⴚ1, mean ⴞ SD) per animal was calculated from weekly fluid intake and weight measurements over
the phases of pre-diabetes (5.4 ⴞ 1, n ⴝ 13), diabetes to polydipsia (4.4 ⴞ 0.7, n ⴝ 16), and polydipsia to death (44 ⴞ 13, n ⴝ 15). Body weights
at diabetes onset were also not significantly different between the control and drug-treated groups. Following onset of polydipsia, the
tetracycline concentrations in the water of matched nontransgenic littermates were increased proportionately to maintain matched drug intake,
and no adverse effects on fluid palatability were observed. Within the transgenic control group, 2 of 22 mice that spontaneously developed
diabetes were omitted from the final analysis due to development of an eye infection and a tumor, respectively, whereas no animals were excluded
from the tetracycline-treated transgenic group. C: Percent survival from diabetes onset (䡺, n ⴝ 17; E, n ⴝ 19). **P < 0.01; *P < 0.05. D:
Relationship between total area of amyloid deposits and lifespan in tetracycline-treated mice (P < 0.001, n ⴝ 12, R2 ⴝ 0.91).
time to diabetes onset in this cohort of mice as compared cycline-treated groups was dosage dependent with signif- with the corresponding water-treated control group (Fig. 4F, icant alleviation of hyperglycemia (P ⬍ 0.01; Fig. 5A) and 98 vs. 66 days, P ⬍ 0.05). These studies showed that corresponding fluid intake (P ⬍ 0.05; Fig. 5B) in the 0.5 improved glucose tolerance and delayed onset of diabetes in mg/ml tetracycline–treated group compared with the wa- tetracycline-treated hemizygous mice were not due to ex- ter-treated controls. The 0.5 mg/ml tetracycline–treated trapancreatic insulin-sensitizing actions or other putative group had a 254% increase in median survival from diabe- systemic effects of tetracycline on glucose homeostasis.
tes onset to death compared with the water-treated con- Amelioration of diabetes and increased lifespan by
trol group (208 vs. 82 days, respectively, P ⬍ 0.05; Fig. 5C), tetracycline were dosage dependent (study 3). To
and there was a significant trend to dosage dependency replicate and extend our previous findings, in particular among the three groups (P ⬍ 0.05).
with regard to dosage-related effects, further groups of Diabetes pathogenesis in hemizygous mice occurred
hemizygous animals that had been administered water through islet ␤-cell dysfunction followed by ␤-cell
from the time of weaning were randomly assigned at the loss. To examine more precisely the effects of tetracycline
time of disease onset to one of the following groups: treatment on islet ␤-cell mass, pancreatic islets were water-only control (n ⫽ 12), water containing 0.03 mg/ml examined in a further independent cohort of diabetic mice tetracycline (n ⫽ 12) (study 3a, Fig. 5), or water containing studied at 6 weeks after disease onset. Hemizygous ani- 0.5 mg/ml tetracycline (n ⫽ 10) (study 3b, Fig. 5). The mals were randomly assigned at disease onset to one of extent of suppression of disease progression in the tetra- two groups: either water-treated control or treatment with DIABETES, VOL. 59, JANUARY 2010 J.F. AITKEN AND ASSOCIATES
Blood Glucose (mM) Starting Blood Glucose (%) Blood Glucose (mM) Starting Blood Glucose (%) Percent Diabetic 20 Blood Glucose (mM 2 Time to diabetes onset (days) FIG. 4. Tetracycline (0.5 mg/ml of drinking water) improved glucose tolerance and delayed diabetes onset. Glucose tolerance tests were compared
between tetracycline-treated (〫) and control water-treated (E) hemizygous mice at baseline (time ⴝ 0) (A) and after 30 (B) and 60 (C) days
treatment. Statistical analysis by two-way ANOVA showed that curves corresponding to tetracycline-treated and control animals differed
significantly after both 30 (P < 0.01) and 60 (P < 0.001) days treatment. Insulin tolerance tests were carried out in a second cohort of animals
after 60 (D) and 90 (E) days equivalent tetracycline treatment. Each point represents the means ⴞ SE of values derived from n ⴝ 12–25 animals.
F: Survival analysis for the second cohort showed significantly delayed diabetes onset in tetracycline-treated mice (n ⴝ 18) versus the
water-treated control group (n ⴝ 20). ***P < 0.01; *P < 0.05. In other experiments with nontransgenic littermates, glucose tolerance and insulin
tolerance tests performed at 0, 60, and 90 days treatment showed that tetracycline administration did not intrinsically affect glucose tolerance
or insulin sensitivity (not shown).
DIABETES, VOL. 59, JANUARY 2010 TETRACYCLINE CURBS DIABETES IN hA/hIAPP MICE
Blood Glucose (mM) Fluid Intake (ml/day) 10 Weeks from diabetes onset FIG. 5. Suppression of diabetes progression by tetracycline treatment was dosage dependent. Tetracycline was administered to hemizygous
animals from the time of diabetes onset at concentrations of either 0.03 mg/ml (䡺) or 0.5 mg/ml (〫) of drinking water and results compared with
those in water-treated control animals (E). Weekly blood glucose values (A) and fluid intakes (B) are shown. Data are means ⴞ SE of values
derived from 6 to 12 animals per point. **P < 0.01; *P < 0.05 for the 0.5 mg/ml tetracycline-treated compared with water-treated control
hemizygous animals. C: Percent survival shown is in animals treated with 0.03 mg/ml tetracycline (n ⴝ 12, P ⴝ 0.08) or 0.5 mg/ml tetracycline (n ⴝ
10, P < 0.05) compared with those receiving water only (n ⴝ 12). There was no significant difference in bodyweight at diabetes onset or in the
median time to diabetes onset across all three diabetic groups, nor did tetracycline exert effects on bodyweight as indicated by similar growth
rates of tetracycline-treated and nontransgenic littermates. No animals were excluded from these analyses.
0.5 mg/ml tetracycline, as was described above for study 6I). These findings showed that insulin area was main- 3b. Interestingly, visual inspection of islets from hemizy- tained within the islets during early- and mid-stage diabe- gous mice with early- to mid-stage diabetes (Fig. 6A) tes in hemizygous transgenic mice with no substantial showed they were structurally well preserved, with insulin reductions in pancreatic insulin content or serum insulin areas similar to those of matched nontransgenic litter- concentrations. They are consistent with islet ␤-cell loss mates (Fig. 6B). Also, quantitative analyses of islet areas as a correlate of later-stage, more severe diabetes (blood revealed no significant between-group difference at this glucose ⬎15 mmol/l).
time-point (Fig. 6C). By contrast, animals with advanceddiabetes had comparatively elevated blood glucose con-centrations and reduced insulin areas, consistent with islet ␤-cell loss (Fig. 6D).
Our findings demonstrate that the amyloid deposits found These qualitative observations were confirmed in an in the pancreatic islets of hA/hIAPP transgenic mice are exhaustive, quantitative blinded comparison of insulin not intrinsically cytotoxic, an observation consistent with areas of 9 –30 islets from individual tetracycline-treated the reported occurrence of islet amyloid in nondiabetic (Fig. 6E) and water-treated (Fig. 6F) hemizygous mice.
humans (2). Perhaps most notably, amyloid deposition Although there was no significant difference in mean was not observed in homozygous animals with severe, insulin area–to–islet area ratios between the two groups early-onset diabetes but was present in both diabetic and (75 ⫾ 4%, n ⫽ 8 vs. 71 ⫾ 7%, n ⫽ 12, respectively), there nondiabetic hemizygous animals, where it was positively was a significant difference in their variance (F test, P ⫽ rather than negatively correlated with lifespan.
0.029), pointing to a between-group difference. This finding In homozygous transgenic animals, the lack of visible was extended in further correlational analyses, which amyloid deposition coupled with the higher intrinsic hA/ showed that there were significant inverse relationships hIAPP expression and significantly depleted pancreatic between blood glucose concentrations and mean islet insulin concentrations at the median time to diabetes insulin area in each group (Fig. 6G). Here, there was a onset were all consistent with islet ␤-cell loss as the major significant difference in the regression slopes between diabetogenic mechanism. Evidence from other hA/hIAPP tetracycline- and water-treated mice (Fig. 6G). In particu- transgenic murine lines has pointed to a role for soluble lar, insulin area–to–islet area ratios in diabetic hemizygous oligomers in the increased frequency of ␤-cell apoptosis in mice, wherein blood glucose concentrations were ⬍15 late-stage diabetes (15,18,19). The corresponding lack of mmol/l, were comparable not only between tetracycline amyloid in our homozygous mice is consistent with this and water-treated mice but also with values in nontrans- pathogenic mechanism and supports a growing body of genic nondiabetic mice, for example as represented by experimental data consistent with the hypothesis that mouse no. 352 (Fig. 6G, ⽧).
cytotoxic effects of prefibrillar aggregates of other amyloi- We quantified pancreatic and serum insulin concentra- dogenic proteins, such as ␤-amyloid and ␣-synuclein, can tions by ELISA in further separate groups of hemizygous elicit cell death (33–37).
mice 6 weeks after the onset of diabetes. Interestingly, Our findings also show that tetracycline can partially although some reduction in total pancreatic insulin con- suppress the progression of diabetes in hemizygous ani- tent was evident in some animals, there was no apparent mals. In study 1, it slowed the rate of deterioration in relationship between insulin content and blood glucose blood glucose and polydipsia after diabetes onset, com- concentrations (Fig. 6H). Similarly, there was no evident pared with matched control animals, which translated into reduction in serum insulin concentrations, and indeed a 34% increase in median survival. By contrast, tetracy- some hemizygous animals displayed comparatively high cline did not delay diabetes onset in this study, although serum insulin concentrations during early diabetes (Fig.
the lack of an effect may simply have reflected the DIABETES, VOL. 59, JANUARY 2010

J.F. AITKEN AND ASSOCIATES
FIG. 6. Quantitative islet immunohistochemistry indicates that ␤-cell dysfunction preceded ␤-cell loss in diabetic hemizygous mice. Pancreatic
islets were analyzed by blinded insulin histochemistry in hemizygous and matched nondiabetic control mice at time points that corresponded to
6 weeks after diabetes onset in each transgenic mouse. A: Insulin staining in a representative islet from a tetracycline-treated (0.5 mg/ml)
transgenic mouse (animal no. 351, ⴙ/ⴚ). B: An islet from its corresponding matched nontransgenic control (animal no. 352, ⴚ/ⴚ). C: Islet areas
did not differ significantly between these two animals. By contrast, shown in D, is an islet from a hemizygous animal with markedly elevated blood
glucose accompanied by a decreased area of islet insulin staining. Scale bar represents 50 ␮m. Quantitative analyses of insulin area–to–islet area
ratios from 9 to 30 islets per animal are shown in a series of individual tetracycline-treated (n ⴝ 9) (E) or water-treated (n ⴝ 12) (F) diabetic
hemizygous transgenic mice; each datum point represents the ratio from a single islet and horizontal lines are arithmetic means. For comparison,
islet analyses for animal no. 352, which is the tetracycline-treated nontransgenic and nondiabetic age-matched control for hemizygous animal no.
351, are shown in E as closed blue diamonds. G: Linear correlation analysis of the relationships between blood glucose values and insulin
area–to–islet area ratios were demonstrated in both groups (both P < 0.0001); there was also a significant difference between the slopes of the
curves in the two groups (P < 0.0001); the solid blue diamond corresponds to the nontransgenic animal whose islet was shown in B. Blood glucose
and pancreatic insulin content (H) and serum insulin concentrations (I) in animals (n ⴝ 3 replicates/mouse); these latter analyses were
performed in separate cohorts of water-treated (E) and tetracycline-treated (0.5 mg/ml, 〫) hemizygous mice studied at the time point 6 weeks
after diabetes onset. Data from matched nontransgenic and nondiabetic mice studied at the corresponding time point are indicated by closed
black symbols. Data in C, H, and I are means ⴞ SE. A, B, and D: BG, blood glucose. (A high-quality color digital representation of this figure is
available in the online issue.)
relatively low dosage administered during the pre-diabetic weaning, significantly delayed disease onset and progres- phase. The likelihood that this explanation is correct was sion. The observed improvement in glucose tolerance in confirmed in study 2, wherein tetracycline administration tetracycline-treated hemizygous mice after 30 and 60 days at the higher dosage of 0.5 mg/ml from 30 days after of treatment is also consistent with observations from DIABETES, VOL. 59, JANUARY 2010 TETRACYCLINE CURBS DIABETES IN hA/hIAPP MICE
study 3, where we again used the higher drug dosage (0.5 mechanism occurs by default in homozygous mice which mg/ml) but with administration from the time of disease possess higher intrinsic hA/hIAPP expression.
onset. In this study, tetracycline exerted a clear, dosage- In summary, our findings show that islet ␤-cell dysfunc- dependent effect to delay the deterioration in blood glu- tion and not mature extracellular amyloid is the underpin- cose regulation and polydipsia, with the higher dosage ning cause for diabetes pathogenesis in hemizygous hA/ causing an increase in median survival of 254% in the hIAPP transgenic mice. Moreover, deposition of micro- period following diabetes onset.
scopically visible amyloid was positively correlated with We found no evidence that the antidiabetes effects lifespan, showing that tissue hA/hIAPP deposits are not evoked by tetracycline in the hemizygous mice were due intrinsically cytotoxic. Treatment with an effective dosage to any putative extrapancreatic effects, since ITTs re- of tetracycline delayed the onset and impeded the progres- vealed that it exerted no detectable systemic insulin- sion of diabetes in hemizygous mice. Consequently, any sensitizing effects in either hemizygous mice or their intervention that allows progressive deposition of (appar- nontransgenic littermates. Furthermore, tetracycline had ently benign) islet amyloid through mechanisms that re- no measurable effects on glucose regulation in nontrans- duce the cytotoxicity of prefibrillar aggregates might be genic littermates. When taken together with the histolog- expected to prevent islet ␤-cell degeneration.
ical analysis of islets 6 weeks after diabetes onset, thesedata point toward preservation of islet ␤-cell function as the mechanism underlying tetracycline's actions to delay These studies were supported by the Endocore Research onset and progression of diabetes, possibly through inter- Trust, the University of Auckland Research Committee, actions with soluble nascent prefibrillar aggregates.
the Maurice & Phyllis Paykel Trust, the Auckland Medical Finally, our findings show that ␤-cell dysfunction and Research Foundation, and Lottery Health (New Zealand).
not ␤-cell loss was responsible for the initial development G.C. acknowledges support by program grants from the of diabetes in these hemizygous mice. Compared with the Foundation for Research, Science, and Technology and by rapid onset and development of diabetes in homozygous the Health Research Council of New Zealand.
animals, diabetes onset and progression were significantly No potential conflicts of interest relevant to this article more gradual in the hemizygous group. Strikingly, non- were reported.
transgenic controls and hemizygous animals had similar We thank John Todd, Cynthia Tse, and John Scott for total pancreatic insulin content at the median time of helpful discussions and gratefully acknowledge Xiaoling diabetes onset. Significantly, their insulin areas were also Li, Vita Chien, Rosemary Smith, Nataliya Olerskeya, Beryl comparable in the early- and mid-stages of diabetes, Davy, and Vernon Tintinger for technical assistance and indicating that no significant loss of ␤-cells had ensued to Vivian Ward for excellent graphics support.
this point in disease progression. Direct measurements ofpancreatic and serum insulin concentrations 6 weeks following diabetes onset, although variable, were also 1. Butler AE, Janson J, Bonner-Weir S, Ritzel R, Rizza RA, Butler PC. ␤-Cell consistent with the above finding, in that there were no deficit and increased ␤-cell apoptosis in humans with type 2 diabetes.
substantive reductions in insulin content and no clear associations with blood glucose concentrations. This ef- 2. Zhao HL, Lai FM, Tong PC, Zhong DR, Yang D, Tomlinson B, Chan JC.
fect is consistent with the development of glucose blind- Prevalence and clinicopathological characteristics of islet amyloid in ness in the islets of at least some hemizygous mice (38).
Chinese patients with type 2 diabetes. Diabetes 2003;52:2759 –2766 3. Opie EL. The relation of diabetes mellitus to lesions of the pancreas: Our experimental analyses were clearly able to discrim- hyaline degeneration of the islands of Langerhans. J Exp Med 1901;5:527– inate a 20% loss in insulin staining area or in islet ␤-cell mass, but such absolute reductions only occurred in 4. Cooper GJS, Willis AC, Clark A, Turner RC, Sim RB, Reid KBM. Purifica- association with advanced diabetes. That no significant tion and characterization of a peptide from amyloid-rich pancreases of reduction in insulin staining area occurred in early- to type 2 diabetic patients. Proc Natl Acad Sci U S A 1987;84:8628 – 8632 5. Westermark P, Wernstedt C, Wilander E, Hayden DW, O'Brien TD, Johnson mid-stage diabetes clearly demonstrates that hA/hIAPP KH. Amyloid fibrils in human insulinoma and islets of Langerhans of the expression does not initially evoke diabetes in hemizygous diabetic cat are derived from a neuropeptide-like protein also present in mice by eliciting overt islet ␤-cell loss. In support of this normal islet cells. Proc Natl Acad Sci U S A 1987;84:3881–3885 conclusion, extensive immunohistochemical analyses re- 6. Goldsbury C, Goldie K, Pellaud J, Seelig J, Frey P, Muller SA, Kistler J, vealed no evidence for ␤-cell apoptosis in pancreatic Cooper GJ, Aebi U. Amyloid fibril formation from full-length and fragments sections from hemizygous mice 6 weeks following diabe- of amylin. J Struct Biol 2000;130:352–362 7. Konarkowska B, Aitken JF, Kistler J, Zhang S, Cooper GJ. The aggregation tes onset, as measured by caspase-3 or terminal deoxynu- potential of human amylin determines its cytotoxicity towards islet cleotidyl transferase-mediated dUTP nick-end labeling beta-cells. FEBS J 2006;273:3614 –3624 staining (data not shown), although the assays we used 8. Janciauskiene S, Ahren B. Different sensitivity to the cytotoxic action of may have been insufficiently sensitive to detect rare apo- IAPP fibrils in two insulin-producing cell lines, HIT-T15 and RINm5F cells.
ptotic cells in affected islets.
Biochem Biophys Res Commun 1998;251:888 – 893 Our findings indicate that below a certain threshold, 9. Zhang S, Liu J, Saafi EL, Cooper GJ. Induction of apoptosis by human amylin in RINm5F islet ␤-cells is associated with enhanced expression of hA/hIAPP expression causes islet ␤-cell dysfunction lead- p53 and p21WAF1/CIP1. FEBS Lett 1999;455:315–320 ing to impaired insulin production, processing, and/or 10. Zhang S, Liu H, Yu H, Cooper GJ. Fas-associated death receptor signaling secretion at the outset of diabetes (14). Here, we could not evoked by human amylin in islet ␤-cells. Diabetes 2008;57:348 –356 investigate insulin processing due to the unavailability of 11. Zhang S, Liu J, MacGibbon G, Dragunow M, Cooper GJ. Increased an appropriate mouse-specific proinsulin ELISA. As amy- expression and activation of c-Jun contributes to human amylin-induced lin expression in our mice is under control of the rat apoptosis in pancreatic islet ␤-cells. J Mol Biol 2002;324:271–285 12. Zhang S, Liu H, Liu J, Tse CA, Dragunow M, Cooper GJ. Activation of insulin 2 promoter, we expect that rising blood glucose activating transcription factor 2 by p38 MAP kinase during apoptosis would establish a positive feedback cycle that progres- induced by human amylin in cultured pancreatic beta-cells. FEBS J sively facilitates islet ␤-cell loss. Presumably, this latter 2006;273:3779 –3791 DIABETES, VOL. 59, JANUARY 2010 J.F. AITKEN AND ASSOCIATES
13. Zhang S, Liu J, Dragunow M, Cooper GJ. Fibrillogenic amylin evokes islet 26. Church GM, Gilbert W. Genomic sequencing. Proc Natl Acad Sci U S A ␤-cell apoptosis through linked activation of a caspase cascade and JNK1.
J Biol Chem 2003;278:52810 –52819 27. van Hulst KL, Born W, Muff R, Oosterwijk C, Blankenstein MA, Lips CJ, 14. Haataja L, Gurlo T, Huang CJ, Butler PC. Islet amyloid in type 2 diabetes, Fischer JA, Ho¨ppener JW. Biologically active human islet amyloid polypep- and the toxic oligomer hypothesis. Endocr Rev 2008;29:303–316 tide/amylin in transgenic mice. Eur J Endocrinol 1997;136:107–113 15. Janson J, Soeller WC, Roche PC, Nelson RT, Torchia AJ, Kreutter DK, 28. Kahn SE, Andrikopoulos S, Verchere CB, Wang F, Hull RL, Vidal J.
Butler PC. Spontaneous diabetes mellitus in transgenic mice expressing Oophorectomy promotes islet amyloid formation in a transgenic mouse human islet amyloid polypeptide. Proc Natl Acad Sci U S A 1996;93:7283– model of type II diabetes. Diabetologia 2000;43:1309 –1312 29. Geisler JG, Zawalich W, Zawalich K, Lakey JR, Stukenbrok H, Milici AJ, 16. Soeller WC, Janson J, Hart SE, Parker JC, Carty MD, Stevenson RW, Soeller WC. Estrogen can prevent or reverse obesity and diabetes in mice Kreutter DK, Butler PC. Islet amyloid-associated diabetes in obese A(vy)/a expressing human islet amyloid polypeptide. Diabetes 2002;51:2158 –2169 mice expressing human islet amyloid polypeptide. Diabetes 1998;47:743– 30. Platt N, da Silva RP, Gordon S. Recognizing death: the phagocytosis of apoptotic cells. Trends Cell Biol 1998;8:365–372 17. Ho¨ppener JW, Oosterwijk C, Nieuwenhuis MG, Posthuma G, Thijssen JH, 31. Aitken JF, Loomes KM, Konarkowska B, Cooper GJ. Suppression by Vroom TM, Ahren B, Lips CJ. Extensive islet amyloid formation is induced polycyclic compounds of the conversion of human amylin into insoluble by development of type II diabetes mellitus and contributes to its progres- amyloid. Biochem J 2003;374:779 –784 sion: pathogenesis of diabetes in a mouse model. Diabetologia 1999;42: 32. Smith DL, Woodman B, Mahal A, Sathasivam K, Ghazi-Noori S, Lowden PA, Bates GP, Hockly E. Minocycline and doxycycline are not beneficial in a 18. Butler AE, Janson J, Soeller WC, Butler PC. Increased ␤-cell apoptosis model of Huntington's disease. Ann Neurol 2003;54:186 –196 prevents adaptive increase in ␤-cell mass in mouse model of type 2 33. Janson J, Ashley RH, Harrison D, McIntyre S, Butler PC. The mechanism of diabetes: evidence for role of islet amyloid formation rather than direct islet amyloid polypeptide toxicity is membrane disruption by intermediate- action of amyloid. Diabetes 2003;52:2304 –2314 sized toxic amyloid particles. Diabetes 1999;48:491– 498 19. Butler AE, Jang J, Gurlo T, Carty MD, Soeller WC, Butler PC. Diabetes due 34. Hardy J, Selkoe DJ. The amyloid hypothesis of Alzheimer's disease: to a progressive defect in ␤-cell mass in rats transgenic for human isletamyloid polypeptide (HIP Rat): a new model for type 2 diabetes. Diabetes progress and problems on the road to therapeutics. Science 2002;297:353– 2004;53:1509 –1516 20. Scrocchi LA, Chen Y, Waschuk S, Wang F, Cheung S, Darabie AA, 35. Lambert MP, Barlow AK, Chromy BA, Edwards C, Freed R, Liosatos M, McLaurin J, Fraser PE. Design of peptide-based inhibitors of human islet Morgan TE, Rozovsky I, Trommer B, Viola KL, Wals P, Zhang C, Finch CE, amyloid polypeptide fibrillogenesis. J Mol Biol 2002;318:697–706 Krafft GA, Klein WL. Diffusible, nonfibrillar ligands derived from A␤1– 42 21. Forloni G, Colombo L, Girola L, Tagliavini F, Salmona M. Anti-amyloido- are potent central nervous system neurotoxins. Proc Natl Acad Sci U S A genic activity of tetracyclines: studies in vitro. FEBS Lett 2001;487:404 – 407 1998;95:6448 – 6453 22. Cardoso I, Merlini G, Saraiva MJ. 4⬘-iodo-4⬘-deoxydoxorubicin and tetra- 36. Goldberg MS, Lansbury PT Jr: Is there a cause-and-effect relationship cyclines disrupt transthyretin amyloid fibrils in vitro producing noncyto- between alpha-synuclein fibrillization and Parkinson's disease? Nat Cell toxic species: screening for TTR fibril disrupters. FASEB J 2003;17:803– Biol 2000;2:E115–119 37. Sousa MM, Cardoso I, Fernandes R, Guimaraes A, Saraiva MJ. Deposition 23. Tagliavini F, Forloni G, Colombo L, Rossi G, Girola L, Canciani B, Angeretti of transthyretin in early stages of familial amyloidotic polyneuropathy: N, Giampaolo L, Peressini E, Awan T, De Gioia L, Ragg E, Bugiani O, evidence for toxicity of nonfibrillar aggregates. Am J Pathol 2001;159:1993– Salmona M. Tetracycline affects abnormal properties of synthetic PrP peptides and PrP(Sc) in vitro. J Mol Biol 2000;300:1309 –1322 38. Andrikopoulos S, Verchere CB, Terauchi Y, Kadowaki T, Kahn SE. ␤-Cell 24. Hogan BL, Costantini F, Lacy E: Manipulating the Mouse Embryo: A glucokinase deficiency and hyperglycemia are associated with reduced Laboratory Manual. Cold Spring Harbor, NY, Cold Spring Harbor Labora- islet amyloid deposition in a mouse model of type 2 diabetes. Diabetes 2000;49:2056 –2062 25. Sambrook J, Fritsch EF, Maniatis T: Molecular Cloning: A Laboratory 39. Percy AJ, Trainor DA, Rittenhouse J, Phelps J, Koda JE. Development of Manual. 2nd ed. Cold Spring Harbor, NY, Cold Spring Harbour Laboratory, sensitive immunoassays to detect amylin and amylin-like peptides in unextracted plasma. Clin Chem 1996;42:576 –585 DIABETES, VOL. 59, JANUARY 2010

Source: http://diabetes.diabetesjournals.org/content/diabetes/59/1/161.full.pdf