|

 

Ibc7.net

Open Access
REPORT ON NEGATIVE RESULT
Bacterial Hash Function Using DNA-Based XOR Logic Reveals Unexpected Behavior of the LuxR Promoter
Brianna Pearson1,‡, Kin H. Lau1,‡, Alicia Al en2, James Barron1,3, Robert Cool2, Kel y Davis4, Wil DeLoache1, Erin Feeney1,
Andrew Gordon2, John Igo5, Aaron Lewis5, Kristi Muscalino4, Madeline Parra4, Pal avi Penumetcha1, Victoria G. Rinker1,6,
Karlesha Roland1,7, Xiao Zhu2, Jeffrey L. Poet5,8, Todd T. Eckdahl2,8, Laurie J. Heyer4,8 and A. Malcolm Campbel 1,8,*
1Department of Biology, Davidson Col ege, Davidson, USA; 2Department of Biology, Missouri Western State University, Missouri, USA; 3Department of Biology, Hampton University, Hampton, USA; 4Department of Mathematics, Davidson Col ege, Davidson, USA; 5Department of Computer Science, Math and Physics, Missouri Western State University, Missouri, USA; 6Woodlawn School, Davidson, USA; 7Department of Mathematics, Spelman Col ege, Atlanta, USA; 8Genome Consortium for Active Teaching (GCAT), Davidson, USA; ‡These authors contributed equal y to this work.
Subject areas; Synthetic biology, Biological
Mathematical Biology and Medicine Introduction: Hash functions are computer algorithms that protect information and secure
Author contribution; J.L.P., T.T.E., L.J.H. and A.
transactions. In response to the NIST's "International Cal for Hash Function", we developed M.C. conceived of the project and supervised the students' work; W.D. did the time-delayed a biological hash function using the computing capabilities of bacteria. We designed a DNA- growth experiments and movie; K.H.L., A.A., J.B., ased XOR logic gate that al ows bacterial colonies arranged in a series on an agar plate to R.C., K.D., W.D., E.F., A.G., A.L., P.P., V.G.R. and X.Z. perform hash function calculations.
performed the wet lab experiments and analyzed the data; K.D., J.I., K.M., M.P. and K.R. designed Results and Discussion: In order to provide each colony with adequate time to process in-
the hash function and did al the mathematical puts and perform XOR logic, we designed and successful y demonstrated a system for time- work; B.P., T.T.E. and A.M.C. wrote the manuscript, with J.L.P. and L.J.H. editing and improving the delayed bacterial growth. Our system is based on the diffusion of ß-lactamase, resulting in destruction of ampicil in. Our DNA-based XOR logic gate design is based on the opposition *Correspondence and requests for materials
of two promoters. Our results showed that Plux and POmpC functioned as expected individu- should be addressed to A.M.C. (macampbel @ al y, but Plux did not behave as expected in the XOR construct. Our data showed that, con- trary to literature reports, the Plux promoter is bidirectional. In the absence of the 3OC6 in- Reviewer; J. Christopher Anderson, UC Berkeley,
ducer, the LuxR activator can bind to the Plux promoter and induce backwards transcription. USA; Sven Panke, ETH Zurich, Switzerland
Editor; Keun Woo Lee, Gyeongsang National
Conclusions and Prospects: Our system of time delayed bacterial growth al ows for the
University, Korea successive processing of a bacterial hash function, and is expected to have utility in other Received July 08, 2011
synthetic biology applications. While testing our DNA-based XOR logic gate, we uncovered Accepted July 15, 2011
a novel function of Plux. In the absence of autoinducer 3OC6, LuxR binds to Plux and activates Published July 18, 2011
backwards transcription. This result advances basic research and has important implications Citation; Pearson, B., et al. Bacterial Hash
for the widespread use of the Plux promoter.
Function Using DNA-Based XOR Logic Reveals Unexpected Behavior of the LuxR Promoter. IBC 2011, 3:10, 1-10. doi: 10.4051/ibc.2011.3.3.0010
Funding: Support is grateful y acknowledged
from NSF UBM grant DMS 0733952 to Davidson Col ege and DMS 0733955 to Missouri Western State University, HHMI grants 52005120 and 52006292 to Davidson Col ege, the James G. Martin Genomics Program at Davidson Col ege, and the Missouri Western State University Foundation and Summer Research Institute.
Competing interest; Al authors declare no
financial or personal conflict that could inappropriately bias their experiments or writing.
Key Words: hash function; time-delayed bacterial growth; DNA-based XOR logic gate;
Plux; LuxR; POmpC; bidirectional promoter; synthetic biology IBC  2011;3:10  •  DOI: 10.4051 / ibc.2011.3.3.0010 Interdisciplinary Bio Central Pearson B, et al.
nary inputs is present. If both inputs are present, or both inputs are absent, the logic gate does not produce an output. Protection of electronic communication is vital to the economic As a proof-of concept, we designed a simple linear hash func- and defense capabilities of our nation. "America's Next Top tion out of a sequential series of bacterial colonies, each of Hash Function" competition, as Wired Magazine describes it, which performs XOR logic on inputs consisting of one bit from recognized the need for a novel hash function in light of recent the message and one bit from the output of the previous colony. attacks on the integrity of the current standard and challenged In addition to this simple linear model, we designed several the global community to design a secure hash function stan- more complex, three dimensional, and detailed alternative dard1. In late 2012, the U.S. National Institute of Standards and hash functions9. As shown in Figure 1, the first colony uses XOR Technology (NIST) will conclude their international competi- logic to respond to two chemical inputs, one in the form of a key tion for the development of a new and improved hash function and the other as the first part of the input message. The output and a winner will be chosen from five finalists. The competition from the first colony is used as input for the second colony, was introduced in November 2007 in response to concerns that along with the next bit of the input message. These two inputs the current standard, SHA-1 (Secure Hash Algorithm) was out- are processed by XOR logic in the second colony and the output of-date and not secure. A secure cryptographic hash algorithm is passed on to each successive colony in the series. The final is essential to authenticate electronic documents and maintain colony output determines the hash value of the input "message". their integrity. Hash functions also protect passwords, software, Encoding an XOR logic gate in a biological system necessi- and monetary transactions from hackers2. A hash function en- tates that a cell differentially respond to an input depending on crypts an input of arbitrary length into a "message digest" code whether the input is presented alone or in combination with of fixed small size in a way that is irreversible, meaning the in- another input. Differential response to an input presents a for- put cannot be deduced from the output. The hash output value midable challenge, which explains why engineering of a direct of a given input string is its "signature" or "fingerprint" that DNA-based XOR gate has not been reported. The assembly of a works to detect document tampering3. The ideal hash function chemistry-based XOR logic gate has been reported, with amines must satisfy three properties: preimage resistance, second prei- and protons as inputs10. Voigt et al. (2011) recently assembled mage resistance, and collision resistance. Preimage resistance an indirect DNA-based XOR gate but only through a combina- refers to the difficulty of finding an input that hashes to a pre- torial circuit consisting of three NOR gates, a buffer gate, and a specified output. Second preimage resistance describes the dif-ficulty of identifying a second input that hashes the same out-put as a given input. Collision resistance is a measure of the likelihood that the same hash value is produced by two distinct inputs. A good hash function is completely irreversible and de-signed so that collisions are as rare as possible. In addition, it should be quick and easy to extract an output from a given in-put message4. In response to the call for a reliable and novel hash function, we developed a biological hash function to be implemented in-side living bacteria. Bacterial computers provide a unique alter-native technology to silicon computers. Cellular computers have the advantage of exhibiting enormous parallel computing capabilities, intercellular communication, ability to interface with the biological world, and reusability5,6. Computing efficien-cy may result from the use of single analog logic gates in a pop-ulation of bacterial computers, as opposed to the thousands of gates required in digital processes used by conventional com-puters7. Furthermore, computer hackers are untrained in de- coding biological computers. We chose the XOR (exclusive OR) logic gate to execute our biological hash function. Among the basic Boolean logic operators, only the XOR and NXOR gates possess an equal chance for an output of 0 or 18. In an XOR log- ic gate, an output is produced if and only if exactly one of the bi- IBC  2011;3:10  •  DOI: 10.4051 / ibc.2011.3.3.0010 Interdisciplinary Bio Central Pearson B, et al.
specific spatial arrange-ment on the agar plate11. Stojanovic et vated in media of high osmolarity. Wild-type E. coli cells pos- al. (2002) designed an in vitro "deoxyribozyme-based" XOR sess the outer membrane pore proteins, OmpF and OmpC, that gate consisting of single-stranded oligonucleotides of switched are reciprocally regulated by the osmolarity of their surround- loops acting as inputs and cleaved oligonucleotide products as ing environment. In high osmolarity media made with the ad- the output12. In contrast to XOR gates, researchers have been dition of NaCl, such as LB, ompC is tran-scribed and cells accu- able to successfully construct and implement other DNA-based mulate the smaller OmpC passive diffusion pores in their mem- Boolean logic gates in vivo, including AND, OR, NOT, NOR, and branes. In low osmolarity media, such as TY, ompF encodes a large diameter pore. A histidine kinase protein, EnvZ, monitors Our goal was to design and test a direct DNA-based XOR log- osmolarity in the vicinity of the cell and phosphorylates a tran- ic gate that could be used in a series of bacterial colonies to im- scription factor, OmpR, and phospho-OmpR promotes tran- plement a hash function. XOR logic requires that the presence scription of ompC via its POmpC promotor17-19. In the context of of two inputs produces no output (Figure 2). In order to accom- the XOR gate, the addition of 3OC6 to the media serves as one plish this result in a biological system, we selected two induc- input while the addition of NaCl (high osmolarity LB media) ible promoters to be placed in opposition to one another. When serves as the other input. When both inputs are present or when both promoters are induced, transcription would be blocked by both are absent, the logic gate is predicted to return no output. the binding of their respective DNA-binding proteins and RNA The XOR gate will be encoded into each of the colonies depict- polymerases. One of the promoters is the Plux promoter, a well- ed in Figure 1. The hash function key will take the form of the documented and widely used synthetic biology part from the presence or absence of 3OC6 and will be one of the two inputs LuxR quorum sensing mechanism. One of the first quorum to the XOR function of the first colony. The other input will be sensing systems discovered, the luxR operon was isolated from the presence or absence of NaCl administered adjacent to the V. fischeri, a marine bacterium living symbiotically within the first colony, representing the first part of the message. The first squid Euprymna scolopes14. According to the literature14,15 the colony will process these two inputs and deliver an output in tran-scriptional activator protein LuxR must first bind to its li- the form of the presence or absence of 3OC6 to the second col- gand, the chemical autoinducer 3-oxo-C6-homoserine lactone ony. The second XOR input for this colony will be the presence (3OC6), before LuxR can bind to, and subsequently activate, the or absence of NaCl administered adjacent to the second colony, promoter Plux. The autoinducer 3OC6 is synthesized by the bac- representing the second part of the message. In this way, suc- terially encoded LuxI enzyme. Once Plux is activated, the luxI cessive colonies will process the message, with the output from gene is transcribed at a high rate, initiating a positive feedback the previous colony as the presence or absence of 3OC6 con- autoinduction circuit. For the opposing promoter, we utilized nected to the expression of a reporter gene such as RFP in the the ompC/envZ signaling system16. POmpC is part of the endoge- final colony.
nous osmotic stress response unit in E. coli that becomes acti- The design of our DNA-based XOR gate was based on an un-derstanding of the molecular mechanisms by which the two promoters function, as documented in the literature. The two promoters functioned as expected when tested individually, but we detected aberrant behavior when testing the complete XOR configuration with opposing promoters. Frequently in syn-thetic biology, devices function as designed and the project is deemed successful. However, synthetic biology devices occa-sionally fail due to incomplete understanding about parts that are central to the design. It is important that synthetic biologists learn to investigate the reasons for failed designs in the interest of basic research and the purpose of redesign. In this case, we discovered that the transcription factor LuxR and the Plux pro-moter do not function as previously reported14,15. This result contributes to basic research that complements our successful demonstration of time-delayed bacterial growth, which is a con- tribution to applied research.
IBC  2011;3:10  •  DOI: 10.4051 / ibc.2011.3.3.0010 Interdisciplinary Bio Central Pearson B, et al.
RESULTS AND DISCUSSION
In order for the XOR-based hash function to process informa-tion over time, each colony in the series must perform its logic sequentially. If all colonies grew simultaneously, the hash func-tion would fail because colonies at the end of the chain would perform their XOR logic before the input from the previous col-ony had reached them. Thus, we needed to devise a mechanism of time-delayed growth so that colonies would sequentially process their inputs and pass along their output to the next col-ony before the following colony had grown and performed XOR logic. A literature search failed to uncover a technique to accom-plish time-delayed growth in a simple and inexpensive way. We took advantage of the often unintended consequence of satel-lite colonies forming when transformed colonies are left on an ampicillin selection plate too long20. Following a bacterial cell transformation, satellite colonies can form around resistant colonies containing cells that successfully integrated an ampi- cillin-resistance plasmid. Ampicillin is often mistakenly thought to kill E. coli outright but ampicillin and other ß-lactams pre- colony growth. We measured the rate of ampicillin inactivation vent cell wall peptidoglycan synthesis by the competitive inhi- as a function of three variables: initial ampicillin concentration, bition of a transpeptidase21, thereby preventing the bacteria agar concentration, and temperature (Figure 4). Over the course from forming new cell walls during cell division. Ampicillin-re- of three days, the appearance of colonies was linear. Ampicillin- sistant cells can secrete up to 90% of the enzyme ß-lactamase sensitive colonies appeared faster with lower concentrations of beyond the periplasmic space when the enzyme is highly ex- ampicillin, as expected (Figure 4A). We hypothesized that high- pressed22. The enzyme cleaves the ß-lactam ring of ampicillin er agar concentrations would slow the diffusion of ß-lactamase and inactivates the antibiotic. Non-ampicillin-resistant satellite across the plate and therefore slow the ability of colonies to colonies grow because ampicillin is deactivated surrounding grow. Contrary to our expectations, higher agar concentration the ß-lactamase secreting cells and viable ampicillin-sensitive produced faster colony appearances (Figure 4B). Temperature cells can thrive once again after hours of no growth. We exploit- also had an interesting effect on the appearance of non-resis- ed this often undesirable artifact to produce time-delayed colo- tant colonies. At a high concentration of ampicillin (100 µg/ ny growth. Previous research suggested that ß-lactamase dif- mL), there was no significant difference in the rate of delayed fuses slowly through LB agar, thus providing a means to control growth between the 30°C and 37°C (compare Figures 4A and C). the growth of colonies in a time-dependent manner23. We suc- However, at a lower ampicillin concentration (25 µg/mL), ap- cessfully demonstrated time-delayed growth produced by ß- pearance of colonies was 1.5 times faster at 37°C (compare Fig- lactamase diffusion (Figure 3). An inoculant of ampicillin-resis- tant bacteria was placed at one edge of an agar plate with ampi- To test the function of our proposed XOR-based hash func- cillin-sensitive bacteria inoculated every 0.5 cm along a line in tion, we built the construct depicted in Figure 2A. By arranging each of three directions. As the ß-lactamase secreted by the am- the promoters of the OmpR and LuxR signaling system head- picillin-resistant bacteria diffused across the plate, ampicillin- to-head and coupling each to a distinct fluorescent protein sensitive bacteria at increasing distances from the ampicillin- marker, we could determine if XOR logic was processed inside resistant bacteria were able to grow. The spread of colonies over live E. coli cells (Figure 2B). When cells are grown in high salt time indicates that ß-lactamase was conferring ampicillin-re- LB media and without the addition of 3OC6, POmpC should be sistance to colonies sequentially and uni-directionally (A video activated and cells should fluoresce green. When 3OC6 is add- of this time-delay growth can be accessed online). ed to a low salt TY media, Plux should be activated and cells pro- Time-delayed growth could allow for temporal tuning of a ducing LuxR should fluoresce red. When cells are grown in low bacterial hash function since successive colonies would be giv- salt TY media in the absence of 3OC6, or in high salt LB media en adequate time to process their XOR logic. We characterized in the presence of 3OC6, cells should not fluoresce at all. our time-delayed colony growth system further and investigat- Figure 5A shows the results of experiments to test the function ed what variables could be manipulated to govern the rate of of the XOR gate. We measured RFP and GFP fluorescence un- IBC  2011;3:10  •  DOI: 10.4051 / ibc.2011.3.3.0010 Interdisciplinary Bio Central Pearson B, et al.
der all four combinations of inputs in the presence of the LuxR both inputs proved to be the conditions that produced the un- regulatory protein. In the absence of LuxR, we expected that the expected behaviors when LuxR was expressed inside the cells. Plux promoter would not function (Figure 5B). No expression of In order to explain the unexpected behaviors of GFP expres- the RFP gene is expected, and none was observed. We predict- sion, we hypothesized that the Plux promoter was stimulating ed that the absence of LuxR would have no effect on the ability backward transcription in the presence of LuxR but the absence of POmpC to respond to the high osmolarity input of NaCl in the of the 3OC6 autoinducer. The results of expe-riments to test this LB media and that is what we observed. The observation of hypothesis are show in Figure 5C. The test construct was de- GFP expression when both the 3OC6 and high osmolarity in- signed to result in RFP expression only when backwards tran- puts were provided was consistent with the explanation that scription is supported by the BioBrick part containing the Plux LuxR was not available to activate transcription form the Plux promoter. In the absence of LuxR, the addition of 3OC6 did not promoter. In the presence of the LuxR regulatory protein and result in backwards transcription. However, the same construct, absence of both inputs, we observed unexpected GFP expres- with the addition of the LuxR protein, had a very similar level of sion. In the presence of LuxR and the 3OC6 input combined fluorescence with or without the addition of 3OC6. Although with the absence of the high osmolarity NaCl input, we ob- there is less transcription of RFP in the presence of 3OC6 than served RFP expression as predicted. The result of GFP expres- in the absence of 3OC6, the differences are not significant. Per- sion in the presence of the high osmolarity NaCl input and the haps the lower average and larger error bars is due to stochastic absence of the 3OC6 input was also in accord with our expecta- binding of 3OC6 and the resulting inconsistent forward vs. back- tions. When both inputs were present, we observed lower levels ward transcription from the same promoter. The literature indi- of unpredicted GFP expression. The presence or absence of cates that LuxR binds Plux only after 3OC6 binds to LuxR14,15,24-26. IBC  2011;3:10  •  DOI: 10.4051 / ibc.2011.3.3.0010 Interdisciplinary Bio Central Pearson B, et al.
Our results show that the BioBrick part containing Plux supports increased with temperature. Further studies should measure backwards transcription when LuxR is present in the cell and the effects of a wider range of temperatures and ampicillin con- 3OC6 is absent. The backwards transcription from Plux in the centration to understand the interaction between the two vari- presence of LuxR also explains the failure of the XOR gate to ables. Given that over production of -lactamase enhances its perform its logical operations. It is worth noting that the Plux own secretion22, it would be informative to test the effect of plas- promoter used in this study contains only the -10 and -35 re- mid copy-number on sequential bacterial growth, which could gions with a lux box but not the additional 70 bp portion of DNA present an additional method of tuning the growth rate of bac- found in V. fischeri that normally leads to the transcription of teria. In one study, researchers found that employing low-copy plasmids and adding selective pressures with an antibiotic re-sistant gene significantly attenuated internal noise in gene cir- CONCLUSION AND PROSPECTS
cuits29. While we investigated the basic effects of initial ampicil-lin concentration, agar concentration, and temperature, further Our design of a biological hash function using a direct DNA- characterization is required to be able to fully develop and take based XOR logic gate was a novel response to the international advantage of time-delayed colony growth. call for a new and improved standard hash function1,2. Our bac- Our XOR logic gate was based on the opposition of the POmpC terial hash function provided a new approach for a robust and and Plux promoters. The designed logic gate did not function as secure coding system inside live cells compared to current hash predicted because of previously undocumented behavior of the functions based on complex hardware and algorithms. For cer- BioBrick part containing the Plux promoter. In future studies, we tain applications, biological computation is superior to in silico would need to replace the Plux part with one that contains a uni- computation because populations of cells can execute vast directional promoter that becomes activated only in the pres- amounts of processes in parallel relatively inexpensively, and ence of its input signal. Candidate promoters include Ptet, Pbad, because of the cell's natural connection to the living world. For and PlacI, which have been studied for use in other biological our bacterial hash function, we chose to implement an XOR logic gates11,30. Our results indicated that the Plux promoter is bi- logic gate because it integrates two inputs and provides equal directional and is induced "backwards" by LuxR in the absence distribution of outputs27. In addition to a potential hash func- of 3OC6. The backwards transcription in the absence of 3OC6 tion, biological logic gates have been studied for various other had not been documented in the literature14,15,24-26. In the V. purposes and could be extremely useful in agriculture, produc- fischeri genome, the Plux promoter points in the direction of the tion of pharmaceuticals and other products, and in medicine, LuxI gene and away from the LuxR gene. The native luxR gene particularly in the detection of cancer cells28.
has its own promoter "pointed to the left" but low levels of back- In order to implement a simple hash function with a series of wards transcription is possible from the adjacent Plux promoter XOR logic gates, we designed and successfully demonstrated "pointed to the right"24. In these experiments, LuxR was pro- time-delayed growth of bacterial colonies based on the charac- duced by "backwards transcription" in the presence of LuxR teristic diffusion of ß-lactamase in agar. Time-delayed bacterial and 3OC6 but not with LuxR alone. The experiments that growth ensures that each colony would be given sufficient time showed "backwards" promoter activity was 3OC6-dependent to unidirectionally process its inputs and perform XOR logic se- used the full Plux promoter that includes 70 additional bases quentially so that the message would be correctly hashed. An compared to the Plux used in this study. In our experiments, the inexpensive and simple procedure for time-delayed growth level of backwards transcription by Plux in the presence of LuxR could be a valuable tool for synthetic biologists who need sig- alone was greater than that of forwards transcription from Plux nals to be passed to neighboring cells over a defined time peri- in the presence of both LuxR and the inducer 3OC6.
od. As expected, we saw that bacterial growth rate decreased The current study suggests that in the absence of 3OC6, tran- with a greater concentration of ampicillin. We incorrectly hy- scription in the direction of LuxR might also produce a positive pothesized that increased agar concentration would decrease feedback loop for LuxR production31. Backwards transcription bacterial growth rate because it would slow the diffusion of ß- from the Plux promoter could be caused by attachment of LuxR lactamase. After performing a literature search, we found that to known binding sites in Plux. Alternatively, there could be a naficillin, which is structurally similar to ampicillin, is less ef- cryptic promoter in the Plux part that contains additional LuxR fective when agar concentration is high23. Sequestration of the binding sites that have not yet been studied. The behavior of the antibiotic by agar would explain the increased bacterial growth LuxR regulatory protein may also be due to cytoplasmic differ- rate we observed. The observation of a higher bacterial growth ences between its native Vibrio fischeri bacterial cells and E. coli rate at higher temperature for the 25 µg/mL ampicillin concen- cells. The LuxR family of quorum-sensing proteins includes tration suggests that -lactamase enzyme function or diffusion is hundreds of orthologs across many species of prokaryotes. In IBC  2011;3:10  •  DOI: 10.4051 / ibc.2011.3.3.0010 Interdisciplinary Bio Central Pearson B, et al.
nature, E. coli bacteria express a signal receptor in this family tract, 5 g NaCl and 200 µL of 5M NaOH per liter of distilled wa- known as SdiA but do not possess an orthologous enzyme (such ter. TY liquid media was prepared with 10 g of tryptone and 5 g as LuxI) that produces signals (such as 3OC6 and other N-acyl- of yeast extract and no NaCl per liter of distilled water34. LB me- homoserine lactones [AHL]). Instead, E. coli is thought to detect dia was considered to be high osmolarity by comparison to the and respond to the signals produced by other neighboring spe- low osmolarity of the TY media, prepared without addition of cies, but this has been difficult to study32. A recent study by NaCl. Ampicillin was added to a final concentration of 100 µg/ Dyszel et al.33 demonstrated that sdiA is only partially depen- mL. Testing of Plux required the autoinducer 3OC6-HSL (Sigma- dent on AHL because plasmid-based sdiA induced a response Aldrich Cat. # K3007), added to a final concentration of 4 µg/ in two important loci of E. coli, but not chromosome-based sdiA and/or AHL. More research is necessary to investigate the mechanism of AHL detection in E. coli. Since the LuxR we Basic BioBrick assembly
transformed into E. coli was plasmid-based, the similarity to All DNA parts and sub-parts produced for this project were gen- plasmid-based sdiA might influence the unpredicted behavior erated using the standard BioBrick assembly protocol using high of Plux. Perhaps Plux should not be thought of as initiating "back- copy plasmids pSB1AK3, pSB1A2 or pSB1A335, and registered wards" transcription, but Plux with LuxR should be described as on the MIT Registry of Standard Biological Parts36. The Promega a toggle switch that is governed by the presence or absence of Wizard Plus SV Minipreps (Cat. #A1460) kit was used according 3OC6. In our experiments, the level of backwards transcription to the manufacturer's instructions to extract plasmid DNA. Bio- by Plux in the presence of LuxR alone was greater than that of Brick parts were digested with restriction enzymes, EcoRI, XbaI, forwards transcription from Plux in the presence of both LuxR SpeI, and PstI to produce ‘sticky ends' that were used to com- and the inducer 3OC6.
bine BioBrick parts. Digested DNA was purified using 1% aga- We have made progress towards a functional bacterial hash rose gel electrophoresis followed by gel purification with the function with the development and testing of a novel design. QIAGEN QIAquick Gel Extraction Kit (Cat. # 28706). BioBrick We developed and characterized a method for inexpensive and parts with matching ‘sticky ends' were ligated using T4 ligase simple time-delayed growth that is necessary for implementa- produced by Promega. Plasmid DNA was transformed into tion of our hash function and is likely to find general utility in JM109 Z-Competent E. coli cells (Zymo Research Cat. # T3003) synthetic biology. Our DNA-based XOR logic gate did not func- according to the manufacturer's instructions. It is important to tion as expected, so we designed and built control constructs note that JM109 cells express the LacI repressor, which inhibits that provided data in support of more com-plete description of pLac promoters37. Colonies from ligation reactions were the molecular mechanism by which the LuxR activator controls screened by polymerase chain reaction (PCR). All PCR reactions bidirectional transcription from the commonly used Plux pro- in this project were performed using Promega GoTaq Green Master Mix (Cat. # M7123) with the appropriate primers and template DNA. All final constructs were sequenced for verifica- MATERIALS AND METHODS
Construction of basic parts
For measurement of time-delayed bacterial growth, LB agar The 99 base pair POmpC promoter (K199017) was cloned from the plates were prepared by dissolving 1 g Bacto-tryptone, 5 g yeast MC4100 strain of E. coli using polymerase chain reaction (PCR). extract, 10 g NaCl in 800 mL water, adjusting the pH to 7.5 with Primers were synthesized by Eurofins MWG Operon and de- NaOH, adding agar, and adjusting the final volume to 1 L. Agar signed using an online PCR primer design program38. The for- added at a level of 7.5 g was designated 0.5 X, while 15 g was 1.0 ward primer has the sequence 5´ GCATGAATTCGCGGCC- X, and 22.5 g was 1.5 X. After sterilization, amplicillin was add GCTTCTAGAGTTTACATTTTGAAACATCTA 3´. The underlined to final concentrations of 25 µg/mL, 50 µg/mL, or 100 µg/mL. portion is a 20 bp sequence that is the first 20 bp of the POmpC Each plate was inoculated in one corner with 2 µL of an over- promoter19. The 5´ end of the primer is the standard BioBrick night culture of an amplicillin-resistant strain of E. coli. 2 µL of prefix35, consisting of three different restriction sites, EcoRI, NotI amplicillin-sensitive JM109 E. coli overnight culture were inoc- and XbaI, plus four bases (GCAT) to facilitate EcoRI digestion at ulated. Plates were incubated at either 30°C or 37°C for still/ the 5´ end of the PCR product. The reverse primer has the se- video photodocumentation or measurement of the average quence 5´ GCATCTGCAGCGGCCGCTACTAGTAAGTC- distance to the farthest visible colony.
CATTCTCCCCAAAAATG 3´. The underlined portion is a 21 bp Testing of POmpC used low and high osmolarity liquid media. sequence that is complementary to the last 21 bp of the POmpC LB media was prepared with 10 g of tryptone, 5 g of yeast ex- promoter19. The 5´ end of the primer consists of the comple- IBC  2011;3:10  •  DOI: 10.4051 / ibc.2011.3.3.0010 Interdisciplinary Bio Central Pearson B, et al.
ment of the restriction sites of SpeI, NotI, and PstI to form the scription terminators) to the left of it because LuxR is needed standard BioBrick suffix35. The fours bases GCAT were added to for Plux to be activated25. the 5´ of the primer to facilitate PstI digestion on the 3´ end of For the experiment measuring forward activity, the constructs the PCR product (BBa_K199017). PCR was conducted using tested were POmpC +RBS+GFP (BBa_K199019) and Plac+RBS+ MC4100 strain of E. coli as a source of template. The PCR prod- LuxR+TT+ Plux +RBS+GFP+TT (BBa_K09100). BBa_K09100 was uct was purified, ligated into a BioBrick vector, and transformed tested with and without IPTG and 3OC6-HSL. For the experi- into JM109 cells. Putative clones were screened by DNA se- ment measuring backward activity, the constructs tested were RFPrev+RBSrev+POmpC (K199022), RFPrev+RBSrev+Plux (BBa_K19902 The 55 bp Plux promoter (BBa_K199052), which includes the 7), and Plac +RBS+RFP (BBa_J04450) as a control. lux box39, was required to be opposite in orientation relative to For construction of the XOR logic gate, the construct RFPrev+ POmpC in order to facilitate our XOR gate design (Figure 2). The RBSrev+ POmpC (BBa_K199022) was ligated to Plux-rev (BBa_ Plux reverse promoter Plux-rev was generated by assembling four K199052) then to RBS+GFP (BBa_E5500) to make the construct smaller oligos together. The sequences for the four oligos were RFPrev+RBSrev+ POmpC + Plux-rev+RBS+GFP (BBa_K199069). LuxR generated using the online "Oligo Cuts Optimization Pro- expression with the XOR gate (BBa_ K199104) was produced by gram"40. The oligos were modified so that the two ends of Plux ligating the XOR construct (BBa_K199069) to the right of Plac were equivalent to Bio-Brick prefix and suffix that have been di- +RBS+LuxR+TT (BBa_K199103). LuxR production was induced gested with EcoRI and PstI. The oligos were produced by Euro- when IPTG is added and activates P 41 lac . However, it should be fins MWG Operon. The sequences of the oligos were 5´AATTC- noted that Plac is known to be a leaky promoter with significant GCGGCCGCTTCTAGAGTTTATTCGACTA 3´, 5´ TAACAAAC- transcription activity even in the absence of IPTG37.
CATTTTCTTGCGTAAACC TGTACGATCCTACAGGTTACTAG-TAGCGGCCGCTGCA 3´, 5´ TACAGGTTTACGCAAGAAAATG- GTTTGTTATAGTCGAATAAACTCTAGAAGCGGCCGCG 3´, For measurement of fluorescence, 2 mL of liquid media was in- and 5´ GCGGCCGCTACTAGTAACCTGTAGGATCG 3´ to pro- oculated with the appropriate cells and incubated for 18 hours duce a 55 bp promoter with this sequence: 5´ tttattcgactataa- at 37°C with shaking. After incubation, 600 µL of each construct- caaaccattttcttgcgtaaacctgtacgatcctacaggt 3´. From left to right, media combination was transferred to a microwell plate in 200 the assembled promoter contains a -10 region, a spacer, a -35 µL triplicates. The microwell plate was analyzed using a fluo- region followed by one lux box which would classically initiate rometer to obtain an absorbance reading and a fluorescence transcription to the left as written here39. The oligos were mixed intensity for each 200 µL sample. Each fluorescence intensity with 1× annealing buffer (100 mM NaCl; 10 mM Tris-HCl, pH value was divided by its corresponding absorbance (595 nm) 7.4), so that the final concentration of each oligo was 5 µM. This reading to account for the varying levels of growth in each cul- solution was heated to 100°C and allowed to slowly cool to ture tube. Triplicates were then averaged. To measure green room temperature. The annealed oligos were ligated into a Bio- fluorescence, the fluorometer was set at 485 nm for excitation Brick vector, and transformed into JM109 cells. Putative clones and 528 nm for emission measurement. To measure red fluo- were screened by DNA sequencing.
rescence, the fluorometer was set at 540 nm for excitation and 600 nm for emission measurement.
Construction of composite parts
The part RFPrev+ RBSrev (BBa_K199021) was formed by ligating
the pre-existing parts, RFPrev (BBa_J31008) and RBSrev (BBa_J44001). The parts RFPrev+ RBSrev and RBS+GFP (BBa_E5500) We wish to thank the iGEM founders, organizers, and commu- were ligated to Plux (BBa_R0062) and POmpC (K199017) so that two nity for providing a supportive environment for conducting syn- constructs, RFPrev+RBSrev+ (promoter) and (promoter)+RBS+ thetic biology research with undergraduates and Paul Brantley GFP were built for each promoter, except for Plux +RBS+GFP for assistance with the figures. Support is gratefully acknowl- which had been previously built (POmpC -BBa_K199019; BBa_ edged from NSF UBM grant DMS 0733952 to Davidson College K199022; Plux -BBa_K199027). The purpose of the (promoter)+ and DMS 0733955 to Missouri Western State University, HHMI RBS+GFP constructs was to quantify the level of transcription grants 52005120 and 52006292 to Davidson College, the James in the direction the promoter is pointing, while the RFPrev+ G. Martin Genomics Program at Davidson College, and the Mis- RBSrev+(promoter) constructs was used to quantify the amount souri Western State University Foundation and Summer Re- of transcription caused by each promoter in the reverse direc- search Institute. AMC, LJH, JLP, and TTE are members of GCAT, tion. Note that the pre-existing part (BBa_K09100) containing the Genome Consortium for Active Teaching.
Plux +RBS+GFP also contained Plac +RBS+LuxR+TT (TT is a tran- IBC  2011;3:10  •  DOI: 10.4051 / ibc.2011.3.3.0010 Interdisciplinary Bio Central Pearson B, et al.
Biol Chem 281, 17114-17123.
20. OpenWetWare (2008). Ampicillin. (http://openwetware.org/wiki/ Am- 1. Schneier, B. (2008). America's next top hash function. [http://www.
picillin). Accessed 25 May, 2011.
21. Chandrakala, B., Elias, B.C., Mehra, U., Umapathy, N.S., Dwarakanath, P., Balganesh, T.S., and deSousa, S.M. (2001). Novel scintillation prox- 2. Mackenzie, D. (2008). Computer science. Cryptologists cook up some imity assay for measuring membrane-associated steps of peptidogly- hash for new 'bake-off'. Science 319, 1480-1481.
can biosynthesis in Escherichia coli. Antimicrob Agents Chemother 45, 3. Barker, E., Bassham, L., Burr, W., Caswell, S., Chang, D., Chang, S-j., Chen, L., Dang, Q., Dworkin, M., Kelsey, J., et al. (2009). Cryptographic 22. Georgiou, G., Shuler, M.L., and Wilson, D.B. (1988). Release of periplas- hash algorithm competition. [http://www. nist.gov/itl/csd/ct/hash_ mic enzymes and other physiological effects of beta-lactamase over- competition.cfm]. The National Institute of Standards and Technology.
production in Escherichia coli. Biotechnol Bioeng 32, 741-748.
4. Tiwari, H., and Asawa, K. (2010). Cryptographic hash function: an ele- 23. Toama, M.A., Issa, A.A., and Ashour, M.S. (1978). Effect of agar percent- vated view. EJSR 43, 452-465.
age, agar thickness, and medium constituents on antibiotics assay by 5. Haynes, K.A., Broderick, M.L., Brown, A.D., Butner, T.L., Dickson, J.O., disc diffusion method. Die Pharmazie 33, 100-102.
Harden, W.L., Heard, L.H., Jessen, E.L., Malloy, K.J., Ogden, B.J., et al. 24. Shadel, G.S., and Baldwin, T.O. (1992). Positive autoregulation of the (2008). Engineering bacteria to solve the Burnt Pancake Problem. J Biol Vibrio fischeri luxR gene. LuxR and autoinducer activate cAMP-catabo- Eng 2, 8.
lite gene activator protein complex-independent and -dependent luxR 6. Baumgardner, J., Acker, K., Adefuye, O., Crowley, S.T., De-loache, W., transcription. J Biol Chem 267, 7696-7702.
Dickson, J.O., Heard, L., Martens, A.T., Morton, N., Ritter, M., et al. (2009). 25. Stevens, A.M., Dolan, K.M., and Greenberg, E.P. (1994). Synergistic bind- Solving a Hamiltonian Path Problem with a bacterial computer. J Biol ing of the Vibrio fischeri LuxR transcriptional activator domain and Eng 3, 11.
RNA polymerase to the lux promoter region. Proc Natl Acad Sci USA 91, 7. Goni-Moreno, A., Redondo-Nieto, M., Arroyo, F., and Castellanos, J. (2010). Biocircuit design through engineering bacterial logic gates. Nat 26. Long, T., Tu, K.C., Wang, Y., Mehta, P., Ong, N.P., Bassler, B.L., and Wing- Comput 10, 1007.
reen, N.S. (2009). Quantifying the integration of quorum-sensing sig- 8. de Silva, A.P., and McClenaghan, N.D. (2004). Molecular-scale logic nals with single-cell resolution. PLoS Biol 7, e68.
gates. Chemistry 10, 574-586.
27. Manuel, S.a.S., N. (2007). XOR-Hash: a hash function based on XOR. 9. Western, D.M. (2008). Our Models. (http://2008.igem.org/Team: Da- WEWoRC 2007.
vidson-Missouri_Western/Our_Models) Accessed 25 May, 2011. iGEM.
28. Anderson, J.C., Clarke, E.J., Arkin, A.P., and Voigt, C.A. (2006). Environ- 10. Credi, A., Balzani, V., Langford, S.J., and Stoddart, J.F. (1997). Logic op- mentally controlled invasion of cancer cells by engineered bacteria. J erations at the molecular level: An XOR gate based on a molecular ma- Mol Biol 355, 619-627.
chine. J Am Chem Soc 119, 2679-2681.
29. Sleight, S.C., Bartley, B.A., Lieviant, J.A., and Sauro, H.M. (2010). Design- 11. Tamsir, A., Tabor, J.J., and Voigt, C.A. (2011). Robust multicellular com- ing and engineering evolutionary robust genetic circuits. J Biol Eng 4, puting using genetically encoded NOR gates and chemical 'wires'. Na- ture 469, 212-215.
30. Hasty, J., McMillen, D., and Collins, J.J. (2002). Engineered gene circuits. 12. Stojanovic, M.N., Mitchell, T.E., and Stefanovic, D. (2002). Deoxyribo- Nature 420, 224-230.
zyme-based logic gates. J Am Chem Soc 124, 3555-3561.
31. Dunlap, P.V. (1999). Quorum regulation of luminescence in Vibrio fisch- 13. Kramer, B.P., Fischer, C., and Fussenegger, M. (2004). BioLogic gates en- eri. J Mol Microbiol Biotechnol 1, 5-12.
able logical transcription control in mammalian cells. Biotechnol Bioeng 32. Ahmer, B.M. (2004). Cell-to-cell signalling in Escherichia coli and Sal- 87, 478-484.
monella enterica. Mol Microbiol 52, 933-945.
14. Egland, K.A., and Greenberg, E.P. (2000). Conversion of the Vibrio fisch- 33. Dyszel, J.L., Soares, J.A., Swearingen, M.C., Lindsay, A., Smith, J.N., and eri transcriptional activator, LuxR, to a repressor. J Bacteriol 182, 805-811.
Ahmer, B.M. (2010). E. coli K-12 and EHEC genes regulated by SdiA. 15. Nasser, W., and Reverchon, S. (2007). New insights into the regulatory PLoS One 5, e8946.
mechanisms of the LuxR family of quorum sensing regulators. Anal 34. Ohashi, K., Yamashino, T., and Mizuno, T. (2005). Molecular basis for Bioanal Chem 387, 381-390.
promoter selectivity of the transcriptional activator OmpR of Escherich- 16. Forst, S., Delgado, J., and Inouye, M. (1989). Phosphorylation of OmpR ia coli: isolation of mutants that can activate the non-cognate kdpABC by the osmosensor EnvZ modulates expression of the ompF and ompC promoter. J Biochem 137, 51-59.
genes in Escherichia coli. Proc Natl Acad Sci USA 86, 6052-6056.
35. Knight, T. (2004). Idempotent Vector Design for Standard Assembly of 17. Jung, K., Hamann, K., and Revermann, A. (2001). K+ stimulates specifi- Biobricks. MIT Articial Intelligence Laboratory, 1-11.
cally the autokinase activity of purified and reconstituted EnvZ of Esch- 36. Retberg, R. (2005). MIT Registry of Standard Biological Parts (http:// erichia coli. J Biol Chem 276, 40896-40902.
partsregistry.org). Accessed 8 May, 2011.
18. Cai, S.J., and Inouye, M. (2002). EnvZ-OmpR interaction and osmoreg- 37. Kennell, D., and Riezman, H. (1977). Transcription and translation ini- ulation in Escherichia coli. J Biol Chem 277, 24155-24161.
tiation frequencies of the Escherichia coli lac operon. J Mol Biol 114, 19. Yoshida, T., Qin, L., Egger, L.A., and Inouye, M. (2006). Transcription regulation of ompF and ompC by a single transcription factor, OmpR. J 38. Barron, J., Parra, M, and Win, M. (2008). BioBrick PCR Primer Designer. IBC  2011;3:10  •  DOI: 10.4051 / ibc.2011.3.3.0010 Interdisciplinary Bio Central Pearson B, et al.
(http://gcat.davidson.edu/iGEM08/bbprimer.html). Accessed 8 May, 40. Harden, L. (2006). Oligo Cuts Optimization Program (http://gcat. da- vidson.edu/IGEM06/oligo.html). Accessed 8 May, 2011.
39. Urbanowski, M.L., Lostroh, C.P., and Greenberg, E.P. (2004). Reversible 41. Jacob, F., Monod, J. (1961). On the regulation of gene activity. Cold acyl-homoserine lactone binding to purified Vibrio fischeri LuxR pro- Spring Harb Symp Quant Biol 26, 193-211.
tein. J Bacteriol 186, 631-637.
IBC  2011;3:10  •  DOI: 10.4051 / ibc.2011.3.3.0010

Source: http://www.ibc7.net/article/file_down.php?pid=265&mode=article_print