|

Rcitd.ajums.ac.ir

Molecular Investigation of Staphylococcus aureus, coa and spa Genes in Ahvaz Hospitals, Staff Nose Compared With Patients Clinical Samples Parviz Afrough 1, *, Mohammad Reza Pourmand 2, Amir Arsalan Sarajian 3, Morteza Saki 1, Sadegh Saremy 41 Department of Laboratory Sciences, Golestan Hospital, Jundishapur University of Medical Sciences, Ahvaz, IR Iran 2 Department of Medical Biotechnology, School of Advanced Technology, Tehran University of Medical sciences, Tehran, IR Iran 3 Khuzestan Jahad University, Health Education Group, Ahvaz, IR Iran 4 Cell and Molecular Biology, Center Lab, Jundishapur University of Medical Sciences, Ahvaz, IR Iran*Corresponding author: Parviz Afrough, Department of Laboratory Sciences, Golestan Hospital, Infectious and Tropical Disease of Research Center, Jundis-hapur University of Medical Sciences, Ahvaz, IR Iran. Tel: +98-9353054720, Fax: +98-6113738330, E-mail: [email protected].
A B S T R A C T
Background: Staphylococcus aureus is one of the important human pathogens which are mainly isolated from wound, skin and contaminated
respiratory excretions. Because many of hospital staff and patients carry this pathogen in their nose or skin, close contacts and touching have special role in spreading the infection in hospitals. Also, antibiotic resistant S. aureus, especially Methicillin Resistant S. aureus (MRSA) have been seen among subjects. Thus, there should be an investigation for Bacteria colonization in nose of hospital staff and patients. Furthermore, investigation of antibiotic resistance pattern and examination of genotyping properties of resistant strains have a high efficacy in control and recognition of infection origin.
Objective: The current study aimed to determine the characteristics of S. aureus isolated from patients and staff in hospitals and compare
them based on coa and spa typing methods.
Materials and Methods: In the current study, 157 clinical specimens were collected from patients who were treated at the Ahvaz medical
university hospitals including 79 specimens (50.3%) from Sina hospital, 34 specimens (21.7%) from Imam Khomeini hospital, and 44 specimens (28%) from Golestan hospital and 157 nose swab specimens from the staff of these hospitals were collected during 2010. coa, spa genes of isolated Bacteria were amplified using PCR.
Result: PCR results showed seven different patterns for staff and five different patterns for patients based on spa gene, and for coa gene five
and six different patterns respectively. In addition, the prevalence of MRSA was 52.5 in staff and 83.7 in patients' specimens. Comparison of genetic diversity of spa, and coa genes in Ahvaz university hospitals doesn't show significant difference (Chi-square and fisher's exact test).
Concloutions: The outcome of this study show that spa and coa typing are suitable meth ods for MRSA isolates typing because it is easy to
use and interpret them, and that these methods can be useful in infection source detection and its control especially in epidemic situations Keywords: Staphylococcus aureus; ProA, Coagulase Copyright 2013, Ahvaz Jundishapur University of Medical Sciences; Published by Kowsar Corp.
Article type: Research Article; Received: 06 May 2012; Revised: 17 Jul 2012; Accepted: 08 Aug 2012; Epub: 01 Jun 2013; Ppub: Jun 2013 Implication for health policy/practice/research/medical education:Results of the current study showed that the repeat region of coa and spa genes can be useful for typing.
Please cite this paper as:Afrough P, Pourmand MR, Sarajian AA, Saki M, Saremy S. Molecular Investigation of Staphylococcus aureus, coa and spa Genes in Ahvaz City Hospitals Staff Nose Compared With Patients Clinical Samples. Jundishapur J Microbiol. 2013; 6(4). e5377. DOI: 10.5812/jjm.5377.
Copyright 2013, Ahvaz Jundishapur University of Medical Sciences; Published by Kowsar Corp.
This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/3.0), which per- mits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Afrough P et al. Staphylococcus aureus, coa and spa Genes in Ahvaz In the current study 157 clinical specimens were select- Staphylococcus aureus is the most important pathogen ed from patients who were treated at the Ahvaz medical of human resources mainly wound, respiratory tract and university hospitals including 79 specimens (50.3%) from skin infections. Infection spreads in hospitals because of sina hospital, 34 specimens (21.7%) from Imam Khomeini close contact and the point that hospitals staff and pa- hospital, and 44 specimens (28%) from Golestan hospital. tients carry antibiotic resistant S.aureus specially (MRSA) Furthermore 157 nose swab specimens from the men- in their nose or on their skin (1, 2). High risk of staphy- tioned hospitals staff were collected during 2010. The lococcus infection in infants, surgery, chemotherapy and coa,spa genes showed relevance to coagulase and protein ICU wards makes enough evidence to examine the pa- A, respectively.
tients and staff for bacteria colonization in their noses. As Using microbiological standard methods including, a result, determination of antibiotic resistance pattern catalase, coagulase and manitol fermentation on mani- and examination of genotyping properties of isolated tol salt agar, the isolated S.aureus was confirmed. Then Bacteria has a special role in recognition of infection ori- the sensitivity of isolates was examined by disk diffusion gin and its control.
method based on CLSI guide direction, against antibiot- Although Pulse Field Gel Electrophoresis (PFGE) is a ics including methicillin (1µg), vancomycin (30µg), peni- standard method for Bacteria gene typing, using PCR cillin (10µg), and mupirocin (5µg). All antibiotic disks for multiplication of coa, spa genes is a better technique were prepared form MAST Company (England).
forthe current experiments, because of its lower cost, no need for experts, more rapid competency (rapidity) 3.2. Polymerase Chain Reaction for Detection of and high throughput ability (3-5). Protein A is coding coa and spa Genes by spa gene and has a polymorphic x region with short The S.aureus genome obtained from 24 hours cultures, sequence. This protein is one of the S.aureus surface pro- extracted with DNA extraction kit (Bioneer Korea) based teins that belong to a group of adhesins called Microbial on kit manual and for amplification of coa ,spa genes the Surface Components Recognizing Adhesive Matrix Mole- below primers were used, cules (MSCRAMMS). This protein reacts to Antibodies and coa 1: (-CCAGACCAAGATTCAATAAQ-) has an important role in immunologic and laboratory coa2: (- AAAGAAAACCACTCACATCGT -) diagnosis (6-8).
The coagulase enzyme is also a virulence factor in addition to its important role in S.aureus diagnosis. PCR was performed in 50 µl reactions containing: The coa gene that codes coagulase enzyme has diver- 5 µl MgCl2, 2.5 µl Buffer 10x, 1.5 µl dNTP, 0.3 µl Taq DNA sity in studied polymorphism of strains (9, 10). Since polymerase, 1.5 µl primer F (20 pm), 1.5 µl primer R about 20 percent of healthy persons were permanent (20pm), and 37.2 ml D.W. Reaction was performed in the vectors and 60 percent of them were recurring vec- thermo cycler (Eppendorf-Germany) by denaturation at tors (11), and multi-drug resistant staff for different 94 for three minutes, followed by 30 cycles of 94˚Cfor species, therefore the risk of these species transfer- 45 seconds, 55˚C for 30 seconds and 72˚Cfor 90 seconds. ring from hospital staff to patients or vice versa (12) is Final extension was five minutes at 72˚Cin the end of a serious problem for hospitals. The main goal of this cycles. The products of the PCR were analyzed by electro- study was to type the collected clinical isolates of Ah- phoresis in a 1% agarose gel and the results were analyzed vaz medical university hospitals (Golestan, Sina and by SPSS ver.14 software. In all of the analyses P value =0.05 Imam Khomeini) and to compare them with typing of was considered.
vector staff isolates.
4. Results
The current study aimed to determine the characteris- 4.1. The Results of Patients tics of S.aureus isolated from patients and staff of hospi- tals and to compare them based on coa and spa typing Among 157 patients under study, 52 patients (33.1%) women and 105 patients (66.9%) were men. 79 patients (50.3%) were from Golestan hospital, 37 patients (21.75%) 3. Materials and Methods
from Imam Khomeini hospital and 44 patients (28%) from Sina hospital. Most of the collected specimens were from wound (46, 29.3%), blood (36, 22.9%), urine (17, 10.8%), 3.1. Sample Collection and Bacterial Species Iden- trachea (15, 4.6%) body fluids (12, 7.6%), abscess (8, 5.1%), respiratory apparatus (7, 4.5%) and other specimens (16, Jundishapur J Microbiol. 2013;6(4):e5377 Staphylococcus aureus, coa and spa Genes in Ahvaz Afrough P et al. 10.2%). Among these specimens, 49 (31.2%) were positive 1). Five different patterns of coa were obtained from staff for S. aureus including 27 specimens (18.3%) from Goles- positive specimens using PCR method. C 4 (700bp) with tan hospital, seven specimens (4%) from Imam Khomeini 8.9% had the highest frequency and other patterns in- hospital and 15 specimens (9.8%) from Sina hospital. 41 cluding C 2 (800bp) with 5.7%, C 3 (650bp) with 1.9%, C 10 isolates (83.7%) were methicillin resistant (MRSA) and all (400bp) ,C 12 (600bp) with 7% followed. From 16 coa speci- isolates were vancomycin sensitive. The most sensitivity mens from Golestan hospital, all patterns were detected after vancomycin was seen against mupirocin. The sen- except C 10 , whereas in 12 specimens from Sina hospital sitivity of isolated S. aureus against Antibiotics are men- all patterns except C 3 were obtained (Table 3 and Figure 1).
tioned in Table 1.
Seven different patterns from spa gene were obtained Six different patterns based on coa gene were obtained among which S 3 (1200bp) with 8.9% was more frequent from S. aureus isolates: C 1 (850bp) with 21.7% had the than other patterns including S 4 (1000bp) with 5.7%, S 6 highest frequency, and C 7 (900bp) with 0.6% had the low- (900bp) with 1.9%, S 7 (800bp) with 1.9%, S 8 (700bp) with est frequency. Other patterns included C 2 (800bp) with 1.3%, S 9 (650bp) with 1.9% and S 11 (850bp) with 3.8% .Only 2.5%, C 3 (650 bp) with 3.2%, C 5 (750bp) with 1.9% and C S 3, S 4 and S 6 were seen in Golestan hospital. All patterns 6 (1000bp) with 1.3%, from 49 clinical isolates, 27 (55.1%) except S 9 were seen in Imam Khomeini hospital (Table 2 from Golestan hospital, 15 (30.6%) from Sina and 7 (14.3%) and Figure 1).
from Imam Khomeini hospital. All Imam Khomeini hos- Based on the obtained results no significant different pital isolates had C 1 pattern. The C 6 adC 7 patterns were among coa, and spa genes patterns with infection source not observed in Sina hospital isolates (Table 3 and Figure and hospital wards were detected (P = 0.90- fisher's ex- act test). Furthermore based on chi2 exam, distribution Among patients isolates five different patterns based frequency of obtained patterns in different hospitals on spa gene were obtained. S 1 (1400bp) with 19.1% had weren't similar. df: 5 , chi2: 212.480 , P ≤ 0.0001.
the highest frequency, and other patterns including S 5 (1500hp) with 7%, S 3 (1200bp) with 2.5% , S 4 (1100bp) with 1.3% and S 6 (900bb) with 1.3% followed. 27 specimens (55.1%) were from Golestan hospital, 15 specimens (30.6%) The S.aureus infections occur recurrently in hospital- from Sina and seven specimens (14.3%) from Imam Kho- ized patients and in spite of Antibiotic therapy, cause meini hospital. In Imam Khomeini hospital only S 1 pat- severe complications (13). Considering the increasing tern was detected and in Sina hospital S 4 pattern was not prevalence of methicillin resistant S. aureus, inhibition of detected (Table 2 and Figure 2).
these infections and determination of spreading center 4.2. The Results of Hospitals Staff in hospitals are definitely important subjects, the carri- ers of methicilln resistant strains have the original role Among hospitals staff, 157 specimens from different in bacteria transmission (14). The current study showed hospitals, Golestan (79 persons , 50.3%), Imam Khomeini methicillin resistance in 83.6% of clinical isolates and hospital (34 persons , 21.7%) and Sina (44 persons ,28%) 52.5% of hospitals Staff s.
were collected. Most of the specimens were obtained Various studies have shown different results of bacte- from nurses (82 specimen,52.2%) , doctors(10 specimens), rial resistance and carrierswhich may be related to vari- servants(39 specimens) and nurse's aides(26 specimens). ous bacterial detecting methods. Aligholi et al. showed After special tests 40 S. aureus (25.4%) were isolated. The 70% methicillin resistant among 338 clinical isolates (15). isolates were , 16 (10.2%) from Golestan hospital, 12 (7.6%) Maleki et al. showed 42% MRSA among 100 clinical isolates from Imam Khomeini hospital and 12 (7.6%) from Sina (16). Mohraz et al. (2003) reported 46.5%, (17). Rahimi et al. hospital. 21 isolates (52.5%) were methicillin resistant in a study on 321 clinical isolates in Ahvaz reported the MRSA 73%, (18). Bagherzade et al. (2007) reported this fre- All isolates were vancomycin sensitive and the most quency 62.1%, (19).
considered resistance related to penicillin with 85% (Table Table 1. Frequency Distribution of Hospitals Staff s and Patients Isolated S. aureus Based on Antibiotic Resistance in Antibiogram
Resistant, No. Sensitive, No. Intermediate, Resistant, No. Sensitive, No. Intermediate,
Jundishapur J Microbiol. 2013;6(4):e5377 Afrough P et al. Staphylococcus aureus, coa and spa Genes in Ahvaz Percent of MRSA in every hospital
Percent of MRSA in Every Hospital
.S M(2) C2: S M(1)-U(1) C3: .S M(1) S F(1)-inter F(1) variability Based on Hospital
variability Based on Hospital
.S M(1) C5: ICU(1) C1: KTP(2)-inter M(1)-inter F(1)-icu(1) C2: inter M(1)-icu(1) C3:S M(1)-U(1)-icu(2) C6: D(2) C7:O(1)- C5: ICU(2) C1: S M(1)-D(2)- U(2)- icu(1)-N infect( 2)-N N C1: N(2)-inter F(1)-S F(1)-D(2)-N S1 : N(1)-inter M(2) -S F(1)-ICU(2)-CCU(5)- KTP(2)-S M(1) S5: inter F(1)-D(2)-icu(2)-OPD(1)-S M(1)-O(1) S3 :S F(1)-icu(1) S4 :O(1)-icu(1) S6 :D(1) S1: D(2)-icu(1)-N fect(1)- S5: S M(1)-U(1)-infect(1) M(1) S6 :icu(1) gene, coa ransplant: M, male; F, female; infect, infectious; c, ransplant: M, male; F, female; infect, infectious; c, S. aureus spa Present of Iso lated
Percent of iso lated
Percent of MRSA in Every Hospital
, Internal; S, Surger , Internal; S, Surger Percent of MRSA in Every Hospital
, Dialysis; inter , Dialysis; inter .S.M(1) S6 :S.F(1) variability Based on
.S(1) S4:icu(1)-N .S(2)-OPD(1) C2: N(2) C12: N(1)-in C3: KTP(1)-infect(1) variability Based on Hospital
spa Hospital W
S3 :N(2)-D(1)-icu(1)-inter M(1)- inter F(1)-N OPD(1) S4 :N(2) N S3:N S9:D(1)-icu(1)-U(1) S10:D(1)- N S3:ccu(1) S4:ccu(1)-KTP(1) In fect(1) S6:S F(1)-KTP(2) S7:icu(1)-S M(1) S8:icu(1) S10:KTP(1)-infect(1) vaz Medical University Hospitals Staff s and Patients Isolated C3: S F(1) C4: N(1)-inter F(1)-S F(1)- S M(1) –D(1) -N ter M(1)-icu(1)-N C2: D(1)-icu(1)-S M(1)-U(1) C4: N icu(2)-U(1) D(1) C10: N C2: S M(1)- ccu(1) KTP(1) C10:infect( 1) SM(1) SM(1)-CCU(1)-ICU(1)-KTP(1) vaz Medical University HospitalsStaff s and Patients Isolated S . aureus
Present of isolated Staff aureus
Present of Iso lated
Frequency Distribution of Frequency Distribution of Sina (44)
Imam Kho meini (34)
Total (157)
Sina (44)
Imam Khomei ni (34)
Total (157)
Jundishapur J Microbiol. 2013;6(4):e5377 Staphylococcus aureus, coa and spa Genes in Ahvaz Afrough P et al. Figure 1. Study of Pattern Diversity of coa, spa, in Ahvaz Hospitals Staff Specimens
A) Column one, coa3 (650bp) gene type, column two, coa10 (400bp) gene type, column three, four, coa 12 (600bp) gene type, column 5 coa2 (800bp) gene type B) Column one to, five, coa2 (800bp) gene type, column six, coa4 (700bp) gene type, column seven, coa 3 (650bp) gene type, column eight, coa12 (600bp) gene type C) Column one, two, spa3 (1200bp) gene type D) Column one, spa9 (650bp) gene type, column two, three, spa11 (8500bp)gene type, column four, spa7 (800bp) gene type, column five, spa6(900bp)gene type, column six, spa8 (700bp) genotype ,column seven, spa4 (1000bp) gene Figure 2. Study of Pattern Diversity of coa, spa, in Ahvaz Hospitals Patients Specimens
M: molecular DNA marker (100 plus -fermentase company) . A) Column one, spa6 gene type (900 bp), column two, five, spa5 gene type(1500 bp), Col- umn three, five, spa4 gene type (1100), column six, spa5 gene type (1500 bp), column seven, spa3 gene type (1200 bp), column eight, spa1 gene type (1400 bp) B) Column one, coa7 (900bp) gene type, column two, three, coa1 (850bp) gene type, column six, coa3 (650bp) gene type, column six spa5 gene type (1500 bp ), column seven, coa6 (1000bp) gene type, column 10, coa5(750bp) gene type, column eight nine, coa2 gene type (800 bp).
The current study is more similar to Rahimi s study the different patterns in these isolates. Present study based on MRSA frequency of staff specimens (18). The shows nine different patterns based on coa gene, and in current study could detect 49 isolates of S. aureus (32%) in this respect, is similar to Ishino et al. (2007) study which clinical specimens and based on spa, coa genes 40 isolates determined eight different patterns of coagene in Japan (25.4%) in hospital staff, further more it could determine Jundishapur J Microbiol. 2013;6(4):e5377 Afrough P et al. Staphylococcus aureus, coa and spa Genes in Ahvaz Bagherzadeh et al. also showed 10 different patterns of 1. Yano K, Minoda Y, Sakawa A, Kuwano Y, Kondo K, Fukushima W, et coa gene in 103 clinical isolates in Tehran that was similar al. Positive nasal culture of methicillin-resistant Staphylococcus to the current study result (20). Shittu et al, also deter- aureus (MRSA) is a risk factor for surgical site infection in ortho- pedics. Acta Orthop. 2009;80(4):486-90.
mined 4 different patterns of coa gene in staphylococcus 2. Anwar MS, Jaffery G, Rehman Bhatti KU, Tayyib M, Bokhari SR. aureusisolates of South Africa using coa typing method in Staphylococcus aureus and MRSA nasal carriage in general pop- their study to C4, C3, C2 and C2 of the current study (21).
ulation. J Coll Physicians Surg Pak. 2004;14(11):661-4.
3. Feizabadi MM, Ghodousi A, Nomanpour B, Omrani M, Shahch- Janwithayanuchi et al. determined 4 different patterns eraghi F. Development of a modified DNA extraction method of coa gene in 129 MRSA isolates from 17 hospitals in Thai- for pulsed-field gel electrophoresis analysis of Staphylococcus land. The most frequent pattern in their study was the 111 aureus and enterococci without using lysostaphin. J Microbiol pattern (37520) that was similar to C4 pattern in size (22). 4. Makgotlho PE, Kock MM, Hoosen A, Lekalakala R, Omar S, Dove M, Mitain et al, also detect 6 different patterns for coa gene et al. Molecular identification and genotyping of MRSA isolates. in 35 MRSA isolates in Japan based on PCR-RFLP method FEMS Immunol Med Microbiol. 2009;57(2):104-15.
(23). Li Q et al, study also showed S11 type of C1 and C2 re- 5. Reva I, Higuchi W, Takano T, Singur O, Ozaki K, Isobe H, et al. A rapid screening method for Panton-Valentine leucocidin-posi- gion of coa gene in hospital isolates (24). In the current tive community-acquired methicillin-resistant Staphylococcus study, 10 different patterns of spa gene were determined aureus belonging to multilocus sequence type 30 and its related by PCR, which were similar to those of Harmsen et al. clone using a combination of multiplex PCR and pulsed-field gel study in Germany, they could determine 10 different pat- electrophoresis. J Infect Chemother. 2009;15(2):75-83.
6. Agius P, Kreiswirth B, Naidich S, Bennett K. Typing Staphylococ- terns of spa gene in 191 MRSA isolates of a university hos- cus aureus using the spa gene and novel distance measures. IEEE/ pital by spa typing (25).
ACM Trans Comput Biol Bioinform. 2007;4(4):693-704.
Modley et al. could determine five types in 320 clinical 7. Mathema B, Mediavilla J, Kreiswirth BN. Sequence analysis of the isolates in south Africa in 2010 by spa typing method variable number tandem repeat in Staphylococcus aureus pro- tein A gene: spa typing. Methods Mol Biol. 2008;431:285-305.
(26). Montensinos et al. also could detect 4 different pat- 8. Mehndiratta PL, Bhalla P, Ahmed A, Sharma YD. Molecular typing terns of spa gene in MRSA isolates using spa and coatyp- of methicillin-resistant Staphylococcus aureus strains by PCR- ing methods (27). And the Mitanni study in Japan in 2005 RFLP of Spa gene: a reference laboratory perspective. Indian J Med showed different patterns of spa gene using PCR-RFLP 9. Tiwari HK, Sapkota D, Sen MR. Evaluation of different tests for de- method on coa, spa genes (23).
tection of Staphylococcus aureus using coagulase (coa) gene PCR The comparison of genetic diversity of coa and spa as the gold standard. Nepal Med Coll J. 2008;10(2):129-31.
genes from patients and staff of different parts of Ahvaz 10. Shopsin B, Gomez M, Waddington M, Riehman M, Kreiswirth BN. Use of coagulase gene (coa) repeat region nucleotide sequenc- medical university hospitals didn't show significant dif- es for typing of methicillin-resistant Staphylococcus aureus ference based on chi-square and fisher's exact tests. Com- strains. J Clin Microbiol. 2000;38(9):3453-6.
parison of determined patterns of patients and staff of 11. Edoh V, Gadou D, Tia H, Gnonsahe D. [Epidemiology and preven- tion of Staphylococcus aureus nasal carriage in patients and Golestan, Sina and Imam Khomeini hospitals, showed ge- staff at the Cococy Hemodialysis Center in Abidjan, Ivory Coast]. netic diversity in the most specimens. However in some Med Trop (Mars). 2003;63(6):590-2.
cases similar bands were seen that may have occurred as 12. Ramdani BN, Bes M, Meugnier H, Forey F, Reverdy ME, Lina G, the results of bacterial transmission among patients and et al. Detection of methicillin-resistant Staphylococcus aureus strains resistant to multiple antibiotics and carrying the Panton- hospital staff.
Valentine leukocidin genes in an Algiers hospital. Antimicr Agents The outcome of this study and the other similar re- searches, show that spa and coa typing are suitable meth- 13. Dmitrenko OA, Shaginian IA, Gintsburg AL. [A study of the poly- ods for MRSA isolates typing because it is easy to use and morphism of mec dna in methycillin-resistant strains of Staphy- lococcus aureus isolated at permanent stations in different re- interpret them, and that these methods can be useful in gions of Russia]. Mol Gen Mikrobiol Virusol. 2005(3):11-7.
infection source detection and its control especially in 14. Garcia-Rodriguez JF, Alvarez-Diaz H, Lorenzo-Garcia MV, Mendez- Lage S, Marino-Callejo A, Sesma-Sanchez P. Non-hospital-asso- ciated methicillin-resistant Staphylococcus aureus and MRSA chronic carrier patients in infection control. Am J Infect Control. 15. Ali Quli M, Eini A. Antibiotic resistance patterns of strains of None declared.
Staphylococcus aureus in hospital samples. J Ahwaz Uni Med Sci. 16. Maleki S, Anjrany Z. Comparison of the sensitivity of the re- sults issued by two different anti-germ disc and E test for oxa- None declared.
cillin and vancomycin antibiotics. Islamic Azad Univ J Med Sci. 17. Mohraz M, Jonaid N. The prevalence of infections with meth- icillin-resistant Staphylococcus aureu. j Ahwaz Uni Med Sci . None declared.
18. Rahimi F, Yousefivand J, editors.Passed the assessment and anal- ysis of antibiotic resistance patterns of mecA gene in Staphylo- coccus aureus strains isolated from medical centers and labora- tories in Ahvaz. Kerman/ Iran. 19. Bagherzadeh S, Pourmand M, Abdul Baqi M, Hosseini M. Investi- Jundishapur J Microbiol. 2013;6(4):e5377 Staphylococcus aureus, coa and spa Genes in Ahvaz Afrough P et al. gate the highly variable region of molecular diversity in hvr and 24. Li QT, Zhu YZ, Dong K, Liu C, Zhou YH, Ni YX, et al. A novel se- antibiotic patterns in Staphylococcus aureus isolates collected quence-based coa genotyping method to discriminate nosoco- from hospitals of Tehran University of Medical Sciences. J School mial methicillin-resistant Staphylococcus aureus isolates. Ir J Health Res Inst. 2007;6(3):339-47.
Med Sci. 2011;180(2):463-8.
20. Ishino K, Tsuchizaki N, Ishikawa J, Hotta K. Usefulness of PCR-re- 25. Harmsen D, Claus H, Witte W, Rothganger J, Turnwald D, Vogel striction fragment length polymorphism typing of the coagulase U. Typing of methicillin-resistant Staphylococcus aureus in a gene to discriminate arbekacin-resistant methicillin-resistant university hospital setting by using novel software for spa re- Staphylococcus aureus strains. J Clin Microbiol. 2007;45(2):607-9.
peat determination and database management. J Clin Microbiol. 21. Shittu A, Lin J, Morrison D, Kolawole D. Identification and molec- ular characterization of mannitol salt positive, coagulase-nega- 26. Moodley A, Oosthuysen WF, Duse AG, Marais E. Molecular char- tive staphylococci from nasal samples of medical personnel and acterization of clinical methicillin-resistant Staphylococcus au- students. J Med Microbiol. 2006;55(Pt 3):317-24.
reus isolates in South Africa. J Clin Microbiol. 2010;48(12):4608-11.
22. Janwithayanuchit I, Ngam-ululert S, Paungmoung P, Rangsi- 27. Montesinos I, Salido E, Delgado T, Cuervo M, Sierra A. Epidemio- panuratn W. Epidemiologic Study of methicillin-resistant Staph- logic genotyping of methicillin-resistant Staphylococcus aureus ylococcus aureus by Coagulase Gene Polymorphism. Sci Asia. by pulsed-field gel electrophoresis at a university hospital and comparison with antibiotyping and protein A and coagulase 23. Mitani N, Koizumi A, Sano R, Masutani T, Murakawa K, Mikasa K, gene polymorphisms. J Clin Microbiol. 2002;40(6):2119-25.
et al. Molecular typing of methicillin-resistant Staphylococcus aureus by PCR-RFLP and its usefulness in an epidemiological study of an outbreak. Jpn J Infect Dis. 2005;58(4):250-2.
Jundishapur J Microbiol. 2013;6(4):e5377

Source: http://rcitd.ajums.ac.ir/_rcitd/documents/b9.pdf